Multiple sequence alignment - TraesCS1B01G369500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G369500 chr1B 100.000 2315 0 0 1 2315 599577003 599579317 0.000000e+00 4276.0
1 TraesCS1B01G369500 chr1B 99.093 1654 12 3 665 2315 599636271 599637924 0.000000e+00 2968.0
2 TraesCS1B01G369500 chr1B 98.851 1653 17 2 665 2315 599982984 599984636 0.000000e+00 2946.0
3 TraesCS1B01G369500 chr1B 98.790 1653 15 5 665 2315 599925796 599927445 0.000000e+00 2937.0
4 TraesCS1B01G369500 chr1B 98.730 1654 17 4 665 2315 599707479 599709131 0.000000e+00 2935.0
5 TraesCS1B01G369500 chr1B 98.548 1653 17 5 665 2315 599836981 599838628 0.000000e+00 2913.0
6 TraesCS1B01G369500 chr1B 96.791 1153 34 3 665 1815 599765441 599766592 0.000000e+00 1921.0
7 TraesCS1B01G369500 chr1B 95.858 676 22 6 1 671 599764501 599765175 0.000000e+00 1088.0
8 TraesCS1B01G369500 chr1B 95.852 675 22 6 1 671 599706541 599707213 0.000000e+00 1086.0
9 TraesCS1B01G369500 chr1B 95.704 675 24 5 1 671 599635332 599636005 0.000000e+00 1081.0
10 TraesCS1B01G369500 chr1B 95.259 675 27 5 1 671 599981901 599982574 0.000000e+00 1064.0
11 TraesCS1B01G369500 chr1B 94.815 675 29 6 1 671 599924586 599925258 0.000000e+00 1048.0
12 TraesCS1B01G369500 chr1B 94.659 674 24 5 1 671 599836047 599836711 0.000000e+00 1035.0
13 TraesCS1B01G369500 chr1B 94.737 456 14 5 1867 2315 599766791 599767243 0.000000e+00 701.0
14 TraesCS1B01G369500 chr1B 96.226 53 0 1 1814 1864 599766621 599766673 4.100000e-13 86.1
15 TraesCS1B01G369500 chr1D 90.863 1182 68 21 662 1815 441740191 441741360 0.000000e+00 1548.0
16 TraesCS1B01G369500 chr1D 87.129 1414 115 34 962 2315 441644236 441645642 0.000000e+00 1541.0
17 TraesCS1B01G369500 chr1D 92.857 672 27 11 1 669 441631626 441632279 0.000000e+00 955.0
18 TraesCS1B01G369500 chr1D 89.785 558 51 5 1 555 441577577 441578131 0.000000e+00 710.0
19 TraesCS1B01G369500 chr1D 90.607 511 37 7 1814 2315 441741389 441741897 0.000000e+00 667.0
20 TraesCS1B01G369500 chr1D 96.122 361 10 4 314 671 441739567 441739926 9.220000e-164 586.0
21 TraesCS1B01G369500 chr1D 95.470 287 10 3 1 285 441739292 441739577 2.710000e-124 455.0
22 TraesCS1B01G369500 chr1D 96.479 142 5 0 828 969 441632663 441632804 3.850000e-58 235.0
23 TraesCS1B01G369500 chr1D 95.868 121 3 2 665 783 441632542 441632662 6.530000e-46 195.0
24 TraesCS1B01G369500 chr1D 78.641 103 17 4 1666 1765 445047933 445048033 1.920000e-06 63.9
25 TraesCS1B01G369500 chr1A 86.548 840 82 18 996 1821 536629864 536629042 0.000000e+00 896.0
26 TraesCS1B01G369500 chr1A 91.561 237 18 1 760 996 536630127 536629893 2.220000e-85 326.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G369500 chr1B 599577003 599579317 2314 False 4276.000000 4276 100.0000 1 2315 1 chr1B.!!$F1 2314
1 TraesCS1B01G369500 chr1B 599635332 599637924 2592 False 2024.500000 2968 97.3985 1 2315 2 chr1B.!!$F2 2314
2 TraesCS1B01G369500 chr1B 599706541 599709131 2590 False 2010.500000 2935 97.2910 1 2315 2 chr1B.!!$F3 2314
3 TraesCS1B01G369500 chr1B 599981901 599984636 2735 False 2005.000000 2946 97.0550 1 2315 2 chr1B.!!$F7 2314
4 TraesCS1B01G369500 chr1B 599924586 599927445 2859 False 1992.500000 2937 96.8025 1 2315 2 chr1B.!!$F6 2314
5 TraesCS1B01G369500 chr1B 599836047 599838628 2581 False 1974.000000 2913 96.6035 1 2315 2 chr1B.!!$F5 2314
6 TraesCS1B01G369500 chr1B 599764501 599767243 2742 False 949.025000 1921 95.9030 1 2315 4 chr1B.!!$F4 2314
7 TraesCS1B01G369500 chr1D 441644236 441645642 1406 False 1541.000000 1541 87.1290 962 2315 1 chr1D.!!$F2 1353
8 TraesCS1B01G369500 chr1D 441739292 441741897 2605 False 814.000000 1548 93.2655 1 2315 4 chr1D.!!$F5 2314
9 TraesCS1B01G369500 chr1D 441577577 441578131 554 False 710.000000 710 89.7850 1 555 1 chr1D.!!$F1 554
10 TraesCS1B01G369500 chr1D 441631626 441632804 1178 False 461.666667 955 95.0680 1 969 3 chr1D.!!$F4 968
11 TraesCS1B01G369500 chr1A 536629042 536630127 1085 True 611.000000 896 89.0545 760 1821 2 chr1A.!!$R1 1061

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
264 268 3.366052 TCATTCAACTAAGAAGGGGCC 57.634 47.619 0.0 0.0 30.76 5.8 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1532 2151 2.77637 TACTTCACGGCCGACCCTCT 62.776 60.0 35.9 4.54 0.0 3.69 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
73 75 4.027572 TGTTTGCCTTTCTTCTTGTTCG 57.972 40.909 0.00 0.0 0.00 3.95
230 234 3.838565 TCCACCTGCACCTTTTTATTCA 58.161 40.909 0.00 0.0 0.00 2.57
234 238 4.858692 CACCTGCACCTTTTTATTCATTCG 59.141 41.667 0.00 0.0 0.00 3.34
241 245 6.183360 GCACCTTTTTATTCATTCGACGACTA 60.183 38.462 0.00 0.0 0.00 2.59
264 268 3.366052 TCATTCAACTAAGAAGGGGCC 57.634 47.619 0.00 0.0 30.76 5.80
287 291 9.056005 GGCCCTTGGATTCAAATTATTTTTATC 57.944 33.333 0.00 0.0 31.77 1.75
306 310 6.942886 TTATCCATGTTTTGCACGATTTTC 57.057 33.333 0.00 0.0 0.00 2.29
557 564 7.857885 GCTATTAATTGCACGCTAAAGATTTCT 59.142 33.333 15.67 0.0 0.00 2.52
607 615 4.201910 CGCTTGGTTAACATGGTTAGATGG 60.202 45.833 8.10 0.0 0.00 3.51
1377 1971 6.870439 GGAGGAAAATTTCTGATTTGTTGAGG 59.130 38.462 5.65 0.0 0.00 3.86
1532 2151 4.698304 CCTTGTTTCTTTTATGGCGACCTA 59.302 41.667 0.00 0.0 0.00 3.08
2281 3071 4.367023 TCGGTTCAAGGGTCGCCG 62.367 66.667 0.00 0.0 43.32 6.46
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
73 75 9.139174 TGTAAGTAAACGTATAAAACACTAGCC 57.861 33.333 0.00 0.00 0.00 3.93
193 197 5.222631 CAGGTGGAACAAATACAAAAGCTC 58.777 41.667 0.00 0.00 44.16 4.09
230 234 8.697846 TTAGTTGAATGAAATAGTCGTCGAAT 57.302 30.769 0.00 0.00 0.00 3.34
234 238 8.596380 CCTTCTTAGTTGAATGAAATAGTCGTC 58.404 37.037 0.00 0.00 0.00 4.20
241 245 4.711846 GGCCCCTTCTTAGTTGAATGAAAT 59.288 41.667 0.00 0.00 0.00 2.17
287 291 4.201513 CGATGAAAATCGTGCAAAACATGG 60.202 41.667 0.00 0.00 39.07 3.66
306 310 6.144241 TCACATTGAAAAATCTTTGCACGATG 59.856 34.615 0.00 0.00 0.00 3.84
557 564 1.153369 GCTCCAATGGTGAGCGCTA 60.153 57.895 11.50 0.00 45.05 4.26
607 615 4.281941 GGGGAAGATCCAAATAATCTTGGC 59.718 45.833 3.25 0.00 44.79 4.52
1377 1971 6.602009 AGGTTTGAAGTACATTATGTAAGCCC 59.398 38.462 6.64 1.54 34.21 5.19
1532 2151 2.776370 TACTTCACGGCCGACCCTCT 62.776 60.000 35.90 4.54 0.00 3.69


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.