Multiple sequence alignment - TraesCS1B01G368800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G368800 chr1B 100.000 2552 0 0 1 2552 599166269 599168820 0.000000e+00 4713.0
1 TraesCS1B01G368800 chr1B 97.257 2552 61 6 1 2552 640802633 640805175 0.000000e+00 4316.0
2 TraesCS1B01G368800 chr1B 97.182 2555 61 6 1 2552 641276090 641273544 0.000000e+00 4309.0
3 TraesCS1B01G368800 chr3D 93.816 2571 116 22 1 2543 543087530 543084975 0.000000e+00 3827.0
4 TraesCS1B01G368800 chr1D 94.453 2001 85 12 558 2543 464584450 464586439 0.000000e+00 3057.0
5 TraesCS1B01G368800 chr1D 94.141 512 18 3 1 512 464583871 464584370 0.000000e+00 769.0
6 TraesCS1B01G368800 chr1D 81.174 494 74 17 19 506 464740786 464740306 1.850000e-101 379.0
7 TraesCS1B01G368800 chr1D 80.561 499 72 15 16 506 464745262 464744781 6.710000e-96 361.0
8 TraesCS1B01G368800 chr1D 98.148 54 1 0 2490 2543 464739186 464739133 7.520000e-16 95.3
9 TraesCS1B01G368800 chr1A 93.110 2003 109 15 558 2543 556880054 556882044 0.000000e+00 2907.0
10 TraesCS1B01G368800 chr1A 85.681 866 81 24 1594 2437 557050999 557050155 0.000000e+00 872.0
11 TraesCS1B01G368800 chr1A 93.945 512 26 4 1 512 556879469 556879975 0.000000e+00 769.0
12 TraesCS1B01G368800 chr6D 93.244 1643 78 16 918 2543 103932850 103934476 0.000000e+00 2388.0
13 TraesCS1B01G368800 chr6D 95.312 512 21 2 1 512 103931032 103931540 0.000000e+00 809.0
14 TraesCS1B01G368800 chr6D 94.253 261 14 1 626 886 103932598 103932857 5.120000e-107 398.0
15 TraesCS1B01G368800 chr5A 92.823 1658 84 14 918 2552 412189374 412187729 0.000000e+00 2370.0
16 TraesCS1B01G368800 chr5A 94.203 207 11 1 682 887 412189571 412189365 5.300000e-82 315.0
17 TraesCS1B01G368800 chr6A 92.748 1641 93 12 918 2543 125300218 125301847 0.000000e+00 2348.0
18 TraesCS1B01G368800 chr6A 94.932 513 20 5 1 512 125299165 125299672 0.000000e+00 798.0
19 TraesCS1B01G368800 chr6A 91.484 364 20 2 523 886 125299727 125300079 8.210000e-135 490.0
20 TraesCS1B01G368800 chr7B 89.931 576 44 7 970 1539 28312315 28311748 0.000000e+00 730.0
21 TraesCS1B01G368800 chr7B 89.049 347 16 4 595 931 28313238 28312904 6.570000e-111 411.0
22 TraesCS1B01G368800 chr7D 85.102 443 18 11 525 931 80789210 80788780 2.360000e-110 409.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G368800 chr1B 599166269 599168820 2551 False 4713.000000 4713 100.000000 1 2552 1 chr1B.!!$F1 2551
1 TraesCS1B01G368800 chr1B 640802633 640805175 2542 False 4316.000000 4316 97.257000 1 2552 1 chr1B.!!$F2 2551
2 TraesCS1B01G368800 chr1B 641273544 641276090 2546 True 4309.000000 4309 97.182000 1 2552 1 chr1B.!!$R1 2551
3 TraesCS1B01G368800 chr3D 543084975 543087530 2555 True 3827.000000 3827 93.816000 1 2543 1 chr3D.!!$R1 2542
4 TraesCS1B01G368800 chr1D 464583871 464586439 2568 False 1913.000000 3057 94.297000 1 2543 2 chr1D.!!$F1 2542
5 TraesCS1B01G368800 chr1D 464739133 464745262 6129 True 278.433333 379 86.627667 16 2543 3 chr1D.!!$R1 2527
6 TraesCS1B01G368800 chr1A 556879469 556882044 2575 False 1838.000000 2907 93.527500 1 2543 2 chr1A.!!$F1 2542
7 TraesCS1B01G368800 chr1A 557050155 557050999 844 True 872.000000 872 85.681000 1594 2437 1 chr1A.!!$R1 843
8 TraesCS1B01G368800 chr6D 103931032 103934476 3444 False 1198.333333 2388 94.269667 1 2543 3 chr6D.!!$F1 2542
9 TraesCS1B01G368800 chr5A 412187729 412189571 1842 True 1342.500000 2370 93.513000 682 2552 2 chr5A.!!$R1 1870
10 TraesCS1B01G368800 chr6A 125299165 125301847 2682 False 1212.000000 2348 93.054667 1 2543 3 chr6A.!!$F1 2542
11 TraesCS1B01G368800 chr7B 28311748 28313238 1490 True 570.500000 730 89.490000 595 1539 2 chr7B.!!$R1 944

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
597 5132 1.535204 CCACACTTTGGCCCATGACC 61.535 60.0 0.0 0.0 39.07 4.02 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1635 7846 0.966179 TCTTCGCTGGCTAAGTCACA 59.034 50.0 6.72 0.0 0.0 3.58 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
345 4815 7.441760 TGATTGTGATTTTGACCCAAATTTCAG 59.558 33.333 0.00 0.00 33.19 3.02
597 5132 1.535204 CCACACTTTGGCCCATGACC 61.535 60.000 0.00 0.00 39.07 4.02
634 5169 4.072131 GTGCTGAAACAGAACCCATTCTA 58.928 43.478 2.81 0.00 43.69 2.10
761 6224 8.203681 GGGAACATACTACTGTATTTCCCTAT 57.796 38.462 23.31 0.00 46.39 2.57
788 6251 2.023404 AGGGTTTGTTTTGGGAGAAGGT 60.023 45.455 0.00 0.00 0.00 3.50
817 6281 6.434340 AGGTTTTGAGGAATCAATCAAGTACC 59.566 38.462 16.75 16.75 39.63 3.34
831 6295 5.499139 TCAAGTACCAAAAGCTGACAAAG 57.501 39.130 0.00 0.00 0.00 2.77
1008 7202 2.036217 CCTCCAGCAAGCAATGAACAAA 59.964 45.455 0.00 0.00 0.00 2.83
1079 7273 8.856153 TGGCAATATCTCTGTTGTAGTAAAAA 57.144 30.769 0.00 0.00 0.00 1.94
1213 7412 0.756294 CCCACCGAGCCATATGTGTA 59.244 55.000 1.24 0.00 0.00 2.90
1575 7786 0.240945 CGCGCCAGTTTTCCTCATTT 59.759 50.000 0.00 0.00 0.00 2.32
1635 7846 3.683847 GCATGGAACTCACCAGCTAGATT 60.684 47.826 0.00 0.00 43.49 2.40
1643 7854 4.772624 ACTCACCAGCTAGATTGTGACTTA 59.227 41.667 10.59 0.00 34.30 2.24
1742 7953 3.055530 AGCTATCACCTCAGGTTTGTCTG 60.056 47.826 0.00 0.00 31.02 3.51
1824 8035 8.915057 ATATAAGTAGCTGAATTTCAGTGCAT 57.085 30.769 23.66 12.38 45.94 3.96
2011 8236 6.884096 TGTTTCTTGCACATTTTACAAGTG 57.116 33.333 0.00 0.00 41.22 3.16
2013 8238 6.870965 TGTTTCTTGCACATTTTACAAGTGTT 59.129 30.769 0.00 0.00 41.22 3.32
2014 8239 7.386299 TGTTTCTTGCACATTTTACAAGTGTTT 59.614 29.630 0.00 0.00 41.22 2.83
2073 8301 8.498054 TTGATTCTGTTGTTTTTGGCAAATTA 57.502 26.923 14.29 2.28 0.00 1.40
2298 9123 1.155424 TTTGACCTGTCGGCGAACAC 61.155 55.000 12.92 0.00 0.00 3.32
2373 9199 7.285401 AGTGGTCATTACTTGTCAAACTGAATT 59.715 33.333 0.00 0.00 0.00 2.17
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
225 4695 8.297470 TCCTCGCCTACTAGACTTAAAATTTA 57.703 34.615 0.00 0.00 0.00 1.40
234 4704 3.073209 TCATCATCCTCGCCTACTAGACT 59.927 47.826 0.00 0.00 0.00 3.24
345 4815 8.964476 TTCACCTGAAATCTCATAATCTAACC 57.036 34.615 0.00 0.00 0.00 2.85
597 5132 6.073058 TGTTTCAGCACTTCATACTGCTTAAG 60.073 38.462 0.00 0.00 41.97 1.85
634 5169 3.430042 AGCTTTCCATCATGTCACACT 57.570 42.857 0.00 0.00 0.00 3.55
761 6224 1.840635 CCCAAAACAAACCCTCCCAAA 59.159 47.619 0.00 0.00 0.00 3.28
788 6251 6.975196 TGATTGATTCCTCAAAACCTGAAA 57.025 33.333 0.00 0.00 44.29 2.69
817 6281 2.466846 CTGTGCCTTTGTCAGCTTTTG 58.533 47.619 0.00 0.00 0.00 2.44
1008 7202 8.850156 GTTAGCATGGTTATTACCTTCATGATT 58.150 33.333 1.12 0.00 45.27 2.57
1213 7412 7.285629 TGAATATCTCTCCGTAGTTCTGTGAAT 59.714 37.037 0.00 0.00 0.00 2.57
1457 7660 9.748708 CATTTTAATTCAAGTCAGTCTTCCAAA 57.251 29.630 0.00 0.00 33.63 3.28
1635 7846 0.966179 TCTTCGCTGGCTAAGTCACA 59.034 50.000 6.72 0.00 0.00 3.58
1643 7854 1.267574 TGGGAGATTCTTCGCTGGCT 61.268 55.000 0.00 0.00 0.00 4.75
1742 7953 9.396022 TGGATTTGAAGATAGAAAATGGTAGTC 57.604 33.333 0.00 0.00 0.00 2.59
1824 8035 6.121590 TGCTTGATCAGGCATTACAGAATTA 58.878 36.000 26.87 1.25 38.55 1.40
1931 8149 3.304928 GCAGTGTGAGTTGGAAAGATTGG 60.305 47.826 0.00 0.00 0.00 3.16
2298 9123 2.879103 ACATAACCACTGACCCAAGG 57.121 50.000 0.00 0.00 0.00 3.61
2373 9199 5.445407 GCGAAACATCAACTTGACGCTAATA 60.445 40.000 13.57 0.00 41.25 0.98


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.