Multiple sequence alignment - TraesCS1B01G367600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G367600 chr1B 100.000 3428 0 0 1 3428 598394222 598397649 0.000000e+00 6331.0
1 TraesCS1B01G367600 chr1B 99.446 3431 16 2 1 3428 598378961 598382391 0.000000e+00 6228.0
2 TraesCS1B01G367600 chr1B 98.037 3006 38 6 240 3243 598426107 598429093 0.000000e+00 5204.0
3 TraesCS1B01G367600 chr1B 99.876 2425 2 1 1005 3428 598409998 598412422 0.000000e+00 4460.0
4 TraesCS1B01G367600 chr1B 99.609 511 0 1 1 509 598409477 598409987 0.000000e+00 931.0
5 TraesCS1B01G367600 chr1B 82.892 415 70 1 1786 2199 656406057 656406471 4.180000e-99 372.0
6 TraesCS1B01G367600 chr1B 96.618 207 6 1 1 207 598425712 598425917 3.280000e-90 342.0
7 TraesCS1B01G367600 chr1B 87.543 289 26 3 2718 3005 656410423 656410702 3.300000e-85 326.0
8 TraesCS1B01G367600 chr1B 97.340 188 4 1 3242 3428 598429197 598429384 5.520000e-83 318.0
9 TraesCS1B01G367600 chr4A 91.961 1418 71 6 880 2287 598242217 598240833 0.000000e+00 1947.0
10 TraesCS1B01G367600 chr4A 90.000 350 24 4 2657 3005 598240017 598239678 3.140000e-120 442.0
11 TraesCS1B01G367600 chr4A 85.250 400 39 11 2277 2661 598240456 598240062 8.920000e-106 394.0
12 TraesCS1B01G367600 chr4A 100.000 30 0 0 3382 3411 598239822 598239793 4.780000e-04 56.5
13 TraesCS1B01G367600 chr1D 95.244 862 36 2 820 1676 472184521 472183660 0.000000e+00 1360.0
14 TraesCS1B01G367600 chr1D 94.507 710 32 2 1757 2459 472183187 472182478 0.000000e+00 1088.0
15 TraesCS1B01G367600 chr1D 91.912 544 43 1 257 800 472185048 472184506 0.000000e+00 760.0
16 TraesCS1B01G367600 chr1D 84.689 209 17 4 1 209 472185450 472185257 9.710000e-46 195.0
17 TraesCS1B01G367600 chr1D 98.020 101 2 0 2617 2717 472182344 472182244 3.520000e-40 176.0
18 TraesCS1B01G367600 chr1D 94.340 53 2 1 362 414 472184911 472184860 2.840000e-11 80.5
19 TraesCS1B01G367600 chr2D 78.764 259 55 0 1078 1336 6905152 6904894 1.260000e-39 174.0
20 TraesCS1B01G367600 chr2D 92.453 53 3 1 362 414 560949080 560949029 1.320000e-09 75.0
21 TraesCS1B01G367600 chr6A 71.661 614 144 23 1840 2441 590787 591382 3.570000e-30 143.0
22 TraesCS1B01G367600 chr6A 100.000 30 0 0 422 451 50409954 50409983 4.780000e-04 56.5
23 TraesCS1B01G367600 chr6A 100.000 30 0 0 422 451 50466549 50466578 4.780000e-04 56.5
24 TraesCS1B01G367600 chr7A 100.000 31 0 0 419 449 245593394 245593424 1.330000e-04 58.4


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G367600 chr1B 598394222 598397649 3427 False 6331.000000 6331 100.000000 1 3428 1 chr1B.!!$F2 3427
1 TraesCS1B01G367600 chr1B 598378961 598382391 3430 False 6228.000000 6228 99.446000 1 3428 1 chr1B.!!$F1 3427
2 TraesCS1B01G367600 chr1B 598409477 598412422 2945 False 2695.500000 4460 99.742500 1 3428 2 chr1B.!!$F3 3427
3 TraesCS1B01G367600 chr1B 598425712 598429384 3672 False 1954.666667 5204 97.331667 1 3428 3 chr1B.!!$F4 3427
4 TraesCS1B01G367600 chr1B 656406057 656410702 4645 False 349.000000 372 85.217500 1786 3005 2 chr1B.!!$F5 1219
5 TraesCS1B01G367600 chr4A 598239678 598242217 2539 True 709.875000 1947 91.802750 880 3411 4 chr4A.!!$R1 2531
6 TraesCS1B01G367600 chr1D 472182244 472185450 3206 True 609.916667 1360 93.118667 1 2717 6 chr1D.!!$R1 2716

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
614 777 2.640332 GAGAGGAAGAAGGTGGAGGTTT 59.36 50.0 0.0 0.0 0.0 3.27 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
3175 7608 1.386533 GCATCTGATGGTTGGGACAG 58.613 55.0 18.6 0.0 42.39 3.51 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
614 777 2.640332 GAGAGGAAGAAGGTGGAGGTTT 59.360 50.000 0.0 0.0 0.0 3.27
1003 1176 2.035632 AGGTAGAGAAGGCGAGAATGG 58.964 52.381 0.0 0.0 0.0 3.16
3175 7608 5.835113 TTGAAGCTGCCCTATATGAAAAC 57.165 39.130 0.0 0.0 0.0 2.43
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
558 721 0.031817 AACCCTAGCCTAACCGCCTA 60.032 55.0 0.0 0.0 0.00 3.93
614 777 7.482169 AATAGATCGGCCACTATTCATCTTA 57.518 36.0 16.2 0.0 35.30 2.10
1003 1176 3.054878 CCGTTACTGGTAGTGTGTTGTC 58.945 50.0 0.0 0.0 0.00 3.18
3175 7608 1.386533 GCATCTGATGGTTGGGACAG 58.613 55.0 18.6 0.0 42.39 3.51


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.