Multiple sequence alignment - TraesCS1B01G367500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G367500 chr1B 100.000 4463 0 0 1 4463 598378944 598383406 0.000000e+00 8242.0
1 TraesCS1B01G367500 chr1B 99.216 4463 32 2 1 4463 598394205 598398664 0.000000e+00 8045.0
2 TraesCS1B01G367500 chr1B 99.245 3442 24 2 1024 4463 598409998 598413439 0.000000e+00 6211.0
3 TraesCS1B01G367500 chr1B 98.104 3007 35 7 259 3263 598426107 598429093 0.000000e+00 5217.0
4 TraesCS1B01G367500 chr1B 90.781 781 61 6 3551 4329 598442309 598443080 0.000000e+00 1033.0
5 TraesCS1B01G367500 chr1B 99.621 528 2 0 1 528 598409460 598409987 0.000000e+00 965.0
6 TraesCS1B01G367500 chr1B 96.943 229 6 1 3262 3489 598429197 598429425 2.520000e-102 383.0
7 TraesCS1B01G367500 chr1B 97.321 224 5 1 1 224 598425695 598425917 3.260000e-101 379.0
8 TraesCS1B01G367500 chr1B 82.892 415 70 1 1805 2218 656406057 656406471 5.450000e-99 372.0
9 TraesCS1B01G367500 chr1B 87.543 289 26 3 2737 3024 656410423 656410702 4.310000e-85 326.0
10 TraesCS1B01G367500 chr4A 92.031 1418 70 6 899 2306 598242217 598240833 0.000000e+00 1953.0
11 TraesCS1B01G367500 chr4A 90.000 350 24 4 2676 3024 598240017 598239678 4.100000e-120 442.0
12 TraesCS1B01G367500 chr4A 92.419 277 17 1 2296 2572 598240456 598240184 4.180000e-105 392.0
13 TraesCS1B01G367500 chr4A 100.000 30 0 0 3402 3431 598239822 598239793 6.240000e-04 56.5
14 TraesCS1B01G367500 chr1D 95.360 862 35 2 839 1695 472184521 472183660 0.000000e+00 1365.0
15 TraesCS1B01G367500 chr1D 94.507 710 32 2 1776 2478 472183187 472182478 0.000000e+00 1088.0
16 TraesCS1B01G367500 chr1D 92.096 544 42 1 276 819 472185048 472184506 0.000000e+00 765.0
17 TraesCS1B01G367500 chr1D 86.726 226 15 4 1 226 472185467 472185257 2.080000e-58 237.0
18 TraesCS1B01G367500 chr1D 98.020 101 2 0 2636 2736 472182344 472182244 4.590000e-40 176.0
19 TraesCS1B01G367500 chr1D 88.462 130 13 2 4335 4463 490037164 490037292 5.980000e-34 156.0
20 TraesCS1B01G367500 chr1D 94.340 53 2 1 381 433 472184911 472184860 3.700000e-11 80.5
21 TraesCS1B01G367500 chr2D 89.922 129 12 1 4336 4463 650052905 650053033 9.930000e-37 165.0
22 TraesCS1B01G367500 chr2D 92.453 53 3 1 381 433 560949080 560949029 1.720000e-09 75.0
23 TraesCS1B01G367500 chr7A 88.148 135 15 1 4330 4463 115738013 115738147 4.620000e-35 159.0
24 TraesCS1B01G367500 chr7A 100.000 31 0 0 438 468 245593394 245593424 1.730000e-04 58.4
25 TraesCS1B01G367500 chr7D 88.060 134 13 3 4330 4463 618044374 618044504 5.980000e-34 156.0
26 TraesCS1B01G367500 chr7D 86.777 121 14 2 4182 4302 29103709 29103827 2.800000e-27 134.0
27 TraesCS1B01G367500 chr6D 88.462 130 13 2 4335 4463 447911502 447911630 5.980000e-34 156.0
28 TraesCS1B01G367500 chr6D 88.462 130 13 2 4335 4463 453944147 453944019 5.980000e-34 156.0
29 TraesCS1B01G367500 chr6A 87.591 137 9 7 4333 4463 573150480 573150346 7.730000e-33 152.0
30 TraesCS1B01G367500 chr6A 78.733 221 41 2 1859 2073 590787 591007 4.650000e-30 143.0
31 TraesCS1B01G367500 chr6A 100.000 30 0 0 441 470 50409954 50409983 6.240000e-04 56.5
32 TraesCS1B01G367500 chr6A 100.000 30 0 0 441 470 50466549 50466578 6.240000e-04 56.5


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G367500 chr1B 598378944 598383406 4462 False 8242.000000 8242 100.000000 1 4463 1 chr1B.!!$F1 4462
1 TraesCS1B01G367500 chr1B 598394205 598398664 4459 False 8045.000000 8045 99.216000 1 4463 1 chr1B.!!$F2 4462
2 TraesCS1B01G367500 chr1B 598409460 598413439 3979 False 3588.000000 6211 99.433000 1 4463 2 chr1B.!!$F4 4462
3 TraesCS1B01G367500 chr1B 598425695 598429425 3730 False 1993.000000 5217 97.456000 1 3489 3 chr1B.!!$F5 3488
4 TraesCS1B01G367500 chr1B 598442309 598443080 771 False 1033.000000 1033 90.781000 3551 4329 1 chr1B.!!$F3 778
5 TraesCS1B01G367500 chr1B 656406057 656410702 4645 False 349.000000 372 85.217500 1805 3024 2 chr1B.!!$F6 1219
6 TraesCS1B01G367500 chr4A 598239678 598242217 2539 True 710.875000 1953 93.612500 899 3431 4 chr4A.!!$R1 2532
7 TraesCS1B01G367500 chr1D 472182244 472185467 3223 True 618.583333 1365 93.508167 1 2736 6 chr1D.!!$R1 2735

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1107 1278 1.523154 GGAGGTGCAAACATCGCCAA 61.523 55.0 0.00 0.0 45.57 4.52 F
2194 2762 0.733566 TCGTAATTGACACGGACCGC 60.734 55.0 15.39 0.0 39.82 5.68 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2971 7401 7.332557 TGCGATTTTAGTTCACCCTATTTCTA 58.667 34.615 0.00 0.00 0.00 2.10 R
3810 8349 2.033194 GGCAACCGTCGAGGGAAAG 61.033 63.158 29.83 18.33 46.96 2.62 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1107 1278 1.523154 GGAGGTGCAAACATCGCCAA 61.523 55.000 0.00 0.0 45.57 4.52
2194 2762 0.733566 TCGTAATTGACACGGACCGC 60.734 55.000 15.39 0.0 39.82 5.68
2971 7401 8.917088 CATTGAGAGGTTGGGTAAATGATTAAT 58.083 33.333 0.00 0.0 0.00 1.40
3810 8349 1.095807 GGCTTCGGGTCTTATGGTGC 61.096 60.000 0.00 0.0 0.00 5.01
3820 8359 2.093658 GTCTTATGGTGCTTTCCCTCGA 60.094 50.000 0.00 0.0 0.00 4.04
3931 8470 2.268920 CTAAGGCCGGAAGCTGCA 59.731 61.111 5.05 0.0 43.05 4.41
4092 8631 0.178992 TGGTGGAGTTGCCCTTCTTG 60.179 55.000 0.00 0.0 34.97 3.02
4454 8994 4.336993 ACGCACTACAAAAGATGGAAAACA 59.663 37.500 0.00 0.0 0.00 2.83
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
2971 7401 7.332557 TGCGATTTTAGTTCACCCTATTTCTA 58.667 34.615 0.00 0.00 0.00 2.10
3130 7561 3.181445 ACATGTATTGTGGTGGTGTGAGT 60.181 43.478 0.00 0.00 37.11 3.41
3332 7868 3.623510 AGCGAATTAAGGAGCAAGTTAGC 59.376 43.478 0.00 0.00 0.00 3.09
3810 8349 2.033194 GGCAACCGTCGAGGGAAAG 61.033 63.158 29.83 18.33 46.96 2.62
3931 8470 2.526873 AACTGCCGGGGTGAGACT 60.527 61.111 2.18 0.00 0.00 3.24


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.