Multiple sequence alignment - TraesCS1B01G363300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G363300 chr1B 100.000 2513 0 0 1 2513 592010704 592013216 0 4641
1 TraesCS1B01G363300 chr2B 97.419 2518 53 9 1 2513 143026814 143024304 0 4279
2 TraesCS1B01G363300 chr2B 96.346 2518 81 9 1 2513 692983950 692981439 0 4130
3 TraesCS1B01G363300 chr5B 96.545 2518 77 10 1 2513 192447630 192450142 0 4159
4 TraesCS1B01G363300 chr3B 96.501 2515 77 10 5 2513 577659244 577661753 0 4146
5 TraesCS1B01G363300 chr3B 96.232 2521 78 14 1 2513 31751050 31753561 0 4113
6 TraesCS1B01G363300 chr3B 96.186 2517 81 13 1 2513 434267161 434264656 0 4102
7 TraesCS1B01G363300 chr6B 96.348 2519 83 8 1 2513 690200149 690197634 0 4133
8 TraesCS1B01G363300 chr2A 95.431 2517 81 12 1 2513 596742735 596740249 0 3980
9 TraesCS1B01G363300 chr2A 95.109 2515 85 21 1 2504 538373737 538371250 0 3928
10 TraesCS1B01G363300 chr2A 93.130 655 18 11 1865 2513 677263923 677264556 0 935


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G363300 chr1B 592010704 592013216 2512 False 4641 4641 100.000 1 2513 1 chr1B.!!$F1 2512
1 TraesCS1B01G363300 chr2B 143024304 143026814 2510 True 4279 4279 97.419 1 2513 1 chr2B.!!$R1 2512
2 TraesCS1B01G363300 chr2B 692981439 692983950 2511 True 4130 4130 96.346 1 2513 1 chr2B.!!$R2 2512
3 TraesCS1B01G363300 chr5B 192447630 192450142 2512 False 4159 4159 96.545 1 2513 1 chr5B.!!$F1 2512
4 TraesCS1B01G363300 chr3B 577659244 577661753 2509 False 4146 4146 96.501 5 2513 1 chr3B.!!$F2 2508
5 TraesCS1B01G363300 chr3B 31751050 31753561 2511 False 4113 4113 96.232 1 2513 1 chr3B.!!$F1 2512
6 TraesCS1B01G363300 chr3B 434264656 434267161 2505 True 4102 4102 96.186 1 2513 1 chr3B.!!$R1 2512
7 TraesCS1B01G363300 chr6B 690197634 690200149 2515 True 4133 4133 96.348 1 2513 1 chr6B.!!$R1 2512
8 TraesCS1B01G363300 chr2A 596740249 596742735 2486 True 3980 3980 95.431 1 2513 1 chr2A.!!$R2 2512
9 TraesCS1B01G363300 chr2A 538371250 538373737 2487 True 3928 3928 95.109 1 2504 1 chr2A.!!$R1 2503
10 TraesCS1B01G363300 chr2A 677263923 677264556 633 False 935 935 93.130 1865 2513 1 chr2A.!!$F1 648

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
948 972 0.179001 TCCTCTCGGGCGATATGTCA 60.179 55.0 0.0 0.0 34.39 3.58 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2241 2275 0.519077 GGCTTTGGTTTGAGAGCTCG 59.481 55.0 8.37 0.0 35.53 5.03 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
268 280 9.912634 ACACCAAGTTTATATGTTTTTCTCATG 57.087 29.630 0.00 0.00 0.00 3.07
915 938 2.730715 CGTTCTTCTTCCTCTCGAGCAG 60.731 54.545 7.81 6.24 0.00 4.24
948 972 0.179001 TCCTCTCGGGCGATATGTCA 60.179 55.000 0.00 0.00 34.39 3.58
999 1023 1.112113 CGGTGTATGGTCTAGTGCCT 58.888 55.000 7.42 0.00 0.00 4.75
1207 1232 9.413048 GGATTTTGGTTACATGATTTCGTTTTA 57.587 29.630 0.00 0.00 0.00 1.52
1288 1314 1.678635 TTGGGCTTGCTGGATTCGG 60.679 57.895 0.00 0.00 0.00 4.30
1324 1350 0.758734 CGAGTCCAATCTGCCCCATA 59.241 55.000 0.00 0.00 0.00 2.74
1336 1362 1.378514 CCCCATAACAGTGCCGCTT 60.379 57.895 0.00 0.00 0.00 4.68
1529 1556 5.950883 TCGTTAGAGATGTTTGTCTACTGG 58.049 41.667 0.00 0.00 28.10 4.00
1559 1586 4.756642 CACTGTTTAGCAATCCAAGTCTGA 59.243 41.667 0.00 0.00 0.00 3.27
2013 2045 4.965283 TCCTTTATGGGTCCCTTCATTT 57.035 40.909 10.00 0.00 36.20 2.32
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
257 268 5.499139 TGTGACAAGGTCATGAGAAAAAC 57.501 39.130 0.00 0.00 44.63 2.43
426 447 4.759782 AGTTCGTCCATTTATGAGACCTG 58.240 43.478 0.00 0.00 0.00 4.00
616 638 1.826921 CATGCCTGCCCCACATCTC 60.827 63.158 0.00 0.00 0.00 2.75
728 751 2.643655 CATGTGGTGGTCATGTGCA 58.356 52.632 0.00 0.00 38.17 4.57
915 938 3.580731 CGAGAGGAAGAAACAGAGGAAC 58.419 50.000 0.00 0.00 0.00 3.62
948 972 3.003763 GGGGCTGACGAGGAGGTT 61.004 66.667 0.00 0.00 0.00 3.50
999 1023 3.427161 CAGTCAGTGCATCGAGTCATA 57.573 47.619 0.00 0.00 0.00 2.15
1036 1060 1.864711 CTTCGAAGTCAACCGCTTCAA 59.135 47.619 17.24 0.13 41.61 2.69
1170 1195 7.537596 TGTAACCAAAATCCAAATCTGACAT 57.462 32.000 0.00 0.00 0.00 3.06
1187 1212 8.119845 CGATCATAAAACGAAATCATGTAACCA 58.880 33.333 0.00 0.00 0.00 3.67
1207 1232 2.684881 GGTGGCATTTCTTCACGATCAT 59.315 45.455 0.00 0.00 32.65 2.45
1208 1233 2.083774 GGTGGCATTTCTTCACGATCA 58.916 47.619 0.00 0.00 32.65 2.92
1257 1283 1.533994 GCCCAACCCTTGAAGCCTT 60.534 57.895 0.00 0.00 0.00 4.35
1559 1586 9.236006 ACTAAACAGAGTTGCATTTGAGATAAT 57.764 29.630 0.00 0.00 0.00 1.28
2241 2275 0.519077 GGCTTTGGTTTGAGAGCTCG 59.481 55.000 8.37 0.00 35.53 5.03


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.