Multiple sequence alignment - TraesCS1B01G355400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G355400 chr1B 100.000 2549 0 0 1 2549 584778857 584781405 0.000000e+00 4708.0
1 TraesCS1B01G355400 chr1B 98.976 1660 14 1 303 1959 584797948 584799607 0.000000e+00 2968.0
2 TraesCS1B01G355400 chr1B 93.730 1850 50 27 1 1823 584761577 584763387 0.000000e+00 2713.0
3 TraesCS1B01G355400 chr1B 88.995 1890 106 31 1 1823 584619953 584621807 0.000000e+00 2244.0
4 TraesCS1B01G355400 chr1B 88.901 1892 104 34 1 1823 584574592 584576446 0.000000e+00 2233.0
5 TraesCS1B01G355400 chr1B 87.257 1695 108 48 177 1823 584603540 584605174 0.000000e+00 1836.0
6 TraesCS1B01G355400 chr1B 86.789 1688 122 48 177 1823 584653974 584655601 0.000000e+00 1788.0
7 TraesCS1B01G355400 chr1B 91.765 850 47 13 982 1823 584566230 584567064 0.000000e+00 1160.0
8 TraesCS1B01G355400 chr1B 99.682 314 1 0 1 314 584797227 584797540 2.200000e-160 575.0
9 TraesCS1B01G355400 chr1B 88.506 174 9 4 1 171 584752559 584752724 1.550000e-47 200.0
10 TraesCS1B01G355400 chr1D 90.517 1877 100 28 1 1823 433092164 433094016 0.000000e+00 2409.0
11 TraesCS1B01G355400 chr1D 87.263 1743 102 56 116 1823 433060266 433061923 0.000000e+00 1879.0
12 TraesCS1B01G355400 chr1D 86.481 932 70 19 917 1823 433143196 433144096 0.000000e+00 972.0
13 TraesCS1B01G355400 chr1D 95.455 286 11 1 462 747 433142789 433142506 2.990000e-124 455.0
14 TraesCS1B01G355400 chr1D 84.559 136 9 4 121 249 433140771 433140901 9.580000e-25 124.0
15 TraesCS1B01G355400 chr1A 92.888 1392 64 12 460 1823 531513133 531514517 0.000000e+00 1989.0
16 TraesCS1B01G355400 chr1A 89.481 1407 83 28 460 1823 531561962 531563346 0.000000e+00 1718.0
17 TraesCS1B01G355400 chr1A 89.191 1434 72 31 432 1823 531366982 531368374 0.000000e+00 1712.0
18 TraesCS1B01G355400 chr1A 96.761 247 6 1 100 344 531502261 531502507 6.560000e-111 411.0
19 TraesCS1B01G355400 chr1A 88.693 283 18 10 22 298 531561617 531561891 1.460000e-87 333.0
20 TraesCS1B01G355400 chr1A 88.596 228 15 5 181 401 531512910 531513133 1.500000e-67 267.0
21 TraesCS1B01G355400 chr1A 97.122 139 4 0 1 139 531502123 531502261 4.240000e-58 235.0
22 TraesCS1B01G355400 chr1A 90.667 75 3 2 331 401 531561888 531561962 2.090000e-16 97.1
23 TraesCS1B01G355400 chr3B 87.360 1250 101 29 481 1694 647943920 647942692 0.000000e+00 1380.0
24 TraesCS1B01G355400 chr3B 90.349 601 43 10 1959 2548 805543138 805542542 0.000000e+00 774.0
25 TraesCS1B01G355400 chr3B 90.033 602 46 9 1957 2548 20221238 20221835 0.000000e+00 767.0
26 TraesCS1B01G355400 chr3B 88.018 434 37 7 481 907 647969327 647968902 1.360000e-137 499.0
27 TraesCS1B01G355400 chr4B 93.497 569 29 4 1988 2549 31676425 31676992 0.000000e+00 839.0
28 TraesCS1B01G355400 chr4B 90.333 600 43 10 1960 2548 516310767 516311362 0.000000e+00 773.0
29 TraesCS1B01G355400 chr2B 90.532 602 42 10 1958 2548 94424784 94425381 0.000000e+00 782.0
30 TraesCS1B01G355400 chr6B 90.484 599 43 9 1960 2548 658168289 658167695 0.000000e+00 778.0
31 TraesCS1B01G355400 chrUn 90.167 600 44 10 1960 2548 238094771 238095366 0.000000e+00 767.0
32 TraesCS1B01G355400 chrUn 90.167 600 44 10 1960 2548 359643551 359644146 0.000000e+00 767.0
33 TraesCS1B01G355400 chrUn 90.167 600 44 10 1960 2548 378585760 378585165 0.000000e+00 767.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G355400 chr1B 584778857 584781405 2548 False 4708.000000 4708 100.000000 1 2549 1 chr1B.!!$F8 2548
1 TraesCS1B01G355400 chr1B 584761577 584763387 1810 False 2713.000000 2713 93.730000 1 1823 1 chr1B.!!$F7 1822
2 TraesCS1B01G355400 chr1B 584619953 584621807 1854 False 2244.000000 2244 88.995000 1 1823 1 chr1B.!!$F4 1822
3 TraesCS1B01G355400 chr1B 584574592 584576446 1854 False 2233.000000 2233 88.901000 1 1823 1 chr1B.!!$F2 1822
4 TraesCS1B01G355400 chr1B 584603540 584605174 1634 False 1836.000000 1836 87.257000 177 1823 1 chr1B.!!$F3 1646
5 TraesCS1B01G355400 chr1B 584653974 584655601 1627 False 1788.000000 1788 86.789000 177 1823 1 chr1B.!!$F5 1646
6 TraesCS1B01G355400 chr1B 584797227 584799607 2380 False 1771.500000 2968 99.329000 1 1959 2 chr1B.!!$F9 1958
7 TraesCS1B01G355400 chr1B 584566230 584567064 834 False 1160.000000 1160 91.765000 982 1823 1 chr1B.!!$F1 841
8 TraesCS1B01G355400 chr1D 433092164 433094016 1852 False 2409.000000 2409 90.517000 1 1823 1 chr1D.!!$F2 1822
9 TraesCS1B01G355400 chr1D 433060266 433061923 1657 False 1879.000000 1879 87.263000 116 1823 1 chr1D.!!$F1 1707
10 TraesCS1B01G355400 chr1D 433140771 433144096 3325 False 548.000000 972 85.520000 121 1823 2 chr1D.!!$F3 1702
11 TraesCS1B01G355400 chr1A 531366982 531368374 1392 False 1712.000000 1712 89.191000 432 1823 1 chr1A.!!$F1 1391
12 TraesCS1B01G355400 chr1A 531512910 531514517 1607 False 1128.000000 1989 90.742000 181 1823 2 chr1A.!!$F3 1642
13 TraesCS1B01G355400 chr1A 531561617 531563346 1729 False 716.033333 1718 89.613667 22 1823 3 chr1A.!!$F4 1801
14 TraesCS1B01G355400 chr3B 647942692 647943920 1228 True 1380.000000 1380 87.360000 481 1694 1 chr3B.!!$R1 1213
15 TraesCS1B01G355400 chr3B 805542542 805543138 596 True 774.000000 774 90.349000 1959 2548 1 chr3B.!!$R3 589
16 TraesCS1B01G355400 chr3B 20221238 20221835 597 False 767.000000 767 90.033000 1957 2548 1 chr3B.!!$F1 591
17 TraesCS1B01G355400 chr4B 31676425 31676992 567 False 839.000000 839 93.497000 1988 2549 1 chr4B.!!$F1 561
18 TraesCS1B01G355400 chr4B 516310767 516311362 595 False 773.000000 773 90.333000 1960 2548 1 chr4B.!!$F2 588
19 TraesCS1B01G355400 chr2B 94424784 94425381 597 False 782.000000 782 90.532000 1958 2548 1 chr2B.!!$F1 590
20 TraesCS1B01G355400 chr6B 658167695 658168289 594 True 778.000000 778 90.484000 1960 2548 1 chr6B.!!$R1 588
21 TraesCS1B01G355400 chrUn 238094771 238095366 595 False 767.000000 767 90.167000 1960 2548 1 chrUn.!!$F1 588
22 TraesCS1B01G355400 chrUn 359643551 359644146 595 False 767.000000 767 90.167000 1960 2548 1 chrUn.!!$F2 588
23 TraesCS1B01G355400 chrUn 378585165 378585760 595 True 767.000000 767 90.167000 1960 2548 1 chrUn.!!$R1 588

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1004 3444 2.159517 GCAAGGTAAACTTCCAGATGCG 60.16 50.0 0.0 0.0 37.29 4.73 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2306 4836 3.746045 AGTTACCACACTCGTCATTGT 57.254 42.857 0.0 0.0 0.0 2.71 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1004 3444 2.159517 GCAAGGTAAACTTCCAGATGCG 60.160 50.000 0.00 0.00 37.29 4.73
1084 3527 2.338620 CGACGTCCAACCTCAGCA 59.661 61.111 10.58 0.00 0.00 4.41
1444 3887 0.033601 CAAAATCCCCGGATGGTGGA 60.034 55.000 0.73 0.00 38.48 4.02
1592 4051 2.503375 AGCTGCGCACGTACGTAC 60.503 61.111 22.34 15.19 34.88 3.67
1593 4052 2.503375 GCTGCGCACGTACGTACT 60.503 61.111 22.34 7.87 34.88 2.73
1894 4414 4.553330 TTGATTGGGTACAGGAACTCTC 57.447 45.455 0.00 0.00 34.60 3.20
2013 4533 0.034896 AACAGATCCGCACGACCTTT 59.965 50.000 0.00 0.00 0.00 3.11
2054 4574 2.257371 CTGCGTCGTTCCTTCCGA 59.743 61.111 0.00 0.00 0.00 4.55
2164 4694 3.244561 TGCTTGAAAGAGGATTCGAACCT 60.245 43.478 16.13 16.13 40.80 3.50
2306 4836 5.669164 AAAGTTTGGCTTGGTAACTTTGA 57.331 34.783 10.38 0.00 45.37 2.69
2314 4844 4.219033 GCTTGGTAACTTTGACAATGACG 58.781 43.478 7.99 0.00 37.61 4.35
2317 4847 4.699637 TGGTAACTTTGACAATGACGAGT 58.300 39.130 7.99 0.00 37.61 4.18
2335 4865 4.708421 ACGAGTGTGGTAACTATGGTATGT 59.292 41.667 0.00 0.00 37.61 2.29
2375 4905 8.974292 ATACCATGATAAGGGTGATAACTACT 57.026 34.615 0.00 0.00 38.06 2.57
2379 4909 8.816894 CCATGATAAGGGTGATAACTACTGTAT 58.183 37.037 0.00 0.00 0.00 2.29
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1084 3527 1.136984 CGAAGCTAGCGACGAGGTT 59.863 57.895 24.34 6.77 37.34 3.50
1444 3887 0.321996 GCCTTCTCGAACCTGTCCTT 59.678 55.000 0.00 0.00 0.00 3.36
1592 4051 5.391097 CCAAATTTTACCATGCATGCACAAG 60.391 40.000 25.37 16.83 0.00 3.16
1593 4052 4.454847 CCAAATTTTACCATGCATGCACAA 59.545 37.500 25.37 11.93 0.00 3.33
1894 4414 4.095483 GTCCAGCAACTTGTAATCCATGAG 59.905 45.833 0.00 0.00 0.00 2.90
2136 4666 5.299279 TCGAATCCTCTTTCAAGCACTTTTT 59.701 36.000 0.00 0.00 0.00 1.94
2306 4836 3.746045 AGTTACCACACTCGTCATTGT 57.254 42.857 0.00 0.00 0.00 2.71
2314 4844 4.809426 GCACATACCATAGTTACCACACTC 59.191 45.833 0.00 0.00 0.00 3.51
2317 4847 4.828072 TGCACATACCATAGTTACCACA 57.172 40.909 0.00 0.00 0.00 4.17
2375 4905 6.152661 CCCATGCTTTTTAACCTTCTCATACA 59.847 38.462 0.00 0.00 0.00 2.29
2379 4909 4.735369 TCCCATGCTTTTTAACCTTCTCA 58.265 39.130 0.00 0.00 0.00 3.27
2390 4920 7.494922 AATTACCATACTTTCCCATGCTTTT 57.505 32.000 0.00 0.00 0.00 2.27
2457 4991 7.578310 AAACACCATGATATCTTTCATCCAG 57.422 36.000 3.98 0.00 34.09 3.86


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.