Multiple sequence alignment - TraesCS1B01G354800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G354800 chr1B 100.000 3092 0 0 1 3092 584574078 584577169 0.000000e+00 5710.0
1 TraesCS1B01G354800 chr1B 98.808 3105 23 3 1 3092 584619439 584622542 0.000000e+00 5517.0
2 TraesCS1B01G354800 chr1B 88.691 2025 111 41 386 2369 584778732 584780679 0.000000e+00 2362.0
3 TraesCS1B01G354800 chr1B 87.293 1928 147 45 645 2531 584603477 584605347 0.000000e+00 2115.0
4 TraesCS1B01G354800 chr1B 86.150 2065 142 50 386 2400 584761445 584763415 0.000000e+00 2097.0
5 TraesCS1B01G354800 chr1B 87.921 1813 145 38 645 2437 584653911 584655669 0.000000e+00 2067.0
6 TraesCS1B01G354800 chr1B 89.045 1570 91 25 835 2369 584797948 584799471 0.000000e+00 1871.0
7 TraesCS1B01G354800 chr1B 89.494 1028 67 21 1525 2531 584566230 584567237 0.000000e+00 1262.0
8 TraesCS1B01G354800 chr1B 97.923 337 5 2 2757 3092 584538281 584538616 1.600000e-162 582.0
9 TraesCS1B01G354800 chr1B 87.660 470 25 15 386 846 584797095 584797540 1.640000e-142 516.0
10 TraesCS1B01G354800 chr1B 94.737 285 12 1 403 687 584752447 584752728 1.020000e-119 440.0
11 TraesCS1B01G354800 chr1B 89.130 276 29 1 11 285 584752173 584752448 2.950000e-90 342.0
12 TraesCS1B01G354800 chr1B 95.349 43 2 0 2489 2531 388395218 388395260 5.530000e-08 69.4
13 TraesCS1B01G354800 chr1D 88.889 2052 137 46 372 2378 433092019 433094024 0.000000e+00 2442.0
14 TraesCS1B01G354800 chr1D 89.856 1735 109 31 721 2449 433060330 433062003 0.000000e+00 2167.0
15 TraesCS1B01G354800 chr1D 91.525 295 21 4 39 332 433091732 433092023 1.340000e-108 403.0
16 TraesCS1B01G354800 chr1D 89.610 77 8 0 209 285 433129493 433129569 7.060000e-17 99.0
17 TraesCS1B01G354800 chr1A 89.895 1623 89 29 845 2449 531366891 531368456 0.000000e+00 2019.0
18 TraesCS1B01G354800 chr1A 91.365 1436 92 14 978 2402 531513133 531514547 0.000000e+00 1936.0
19 TraesCS1B01G354800 chr1A 90.237 1434 112 22 978 2402 531561962 531563376 0.000000e+00 1847.0
20 TraesCS1B01G354800 chr1A 88.889 828 58 17 17 841 531561106 531561902 0.000000e+00 989.0
21 TraesCS1B01G354800 chr1A 90.923 650 47 10 11 655 531501619 531502261 0.000000e+00 863.0
22 TraesCS1B01G354800 chr1A 85.714 266 13 7 617 876 531502261 531502507 1.100000e-64 257.0
23 TraesCS1B01G354800 chr1A 84.259 108 8 7 434 532 531510042 531510149 2.540000e-16 97.1
24 TraesCS1B01G354800 chr1A 91.837 49 2 1 2483 2529 24130321 24130369 1.990000e-07 67.6
25 TraesCS1B01G354800 chr3B 82.265 1996 218 81 384 2321 647944507 647942590 0.000000e+00 1600.0
26 TraesCS1B01G354800 chr3B 78.979 1156 130 63 384 1499 647969914 647968832 0.000000e+00 684.0
27 TraesCS1B01G354800 chr3B 83.575 207 32 1 2528 2734 641991541 641991337 3.150000e-45 193.0
28 TraesCS1B01G354800 chr3B 100.000 39 0 0 2493 2531 571808570 571808532 4.280000e-09 73.1
29 TraesCS1B01G354800 chr3A 82.000 2000 209 87 384 2321 628220798 628218888 0.000000e+00 1559.0
30 TraesCS1B01G354800 chr6A 84.698 562 65 10 963 1518 616689143 616688597 2.710000e-150 542.0
31 TraesCS1B01G354800 chr6A 83.415 205 32 1 2528 2732 32227943 32228145 4.070000e-44 189.0
32 TraesCS1B01G354800 chr6A 92.105 76 6 0 812 887 616689241 616689166 1.170000e-19 108.0
33 TraesCS1B01G354800 chr6B 84.541 207 30 1 2528 2734 17988044 17988248 1.450000e-48 204.0
34 TraesCS1B01G354800 chr6B 84.541 207 30 1 2528 2734 347156404 347156200 1.450000e-48 204.0
35 TraesCS1B01G354800 chr6B 83.575 207 32 1 2528 2734 634640393 634640597 3.150000e-45 193.0
36 TraesCS1B01G354800 chr5B 83.092 207 33 1 2528 2734 141583965 141583761 1.460000e-43 187.0
37 TraesCS1B01G354800 chr4A 83.092 207 33 1 2528 2734 729868884 729869088 1.460000e-43 187.0
38 TraesCS1B01G354800 chr7A 83.092 207 32 2 2528 2734 700679876 700680079 5.270000e-43 185.0
39 TraesCS1B01G354800 chr3D 76.955 243 41 4 2493 2734 487249379 487249151 1.160000e-24 124.0
40 TraesCS1B01G354800 chr3D 100.000 39 0 0 2493 2531 488391436 488391398 4.280000e-09 73.1
41 TraesCS1B01G354800 chr2D 100.000 39 0 0 2493 2531 326362689 326362727 4.280000e-09 73.1
42 TraesCS1B01G354800 chr2A 100.000 39 0 0 2493 2531 391353312 391353274 4.280000e-09 73.1
43 TraesCS1B01G354800 chr4D 97.436 39 1 0 2493 2531 80930679 80930641 1.990000e-07 67.6
44 TraesCS1B01G354800 chr7B 89.362 47 5 0 2996 3042 670770803 670770849 3.330000e-05 60.2


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G354800 chr1B 584574078 584577169 3091 False 5710.00 5710 100.0000 1 3092 1 chr1B.!!$F4 3091
1 TraesCS1B01G354800 chr1B 584619439 584622542 3103 False 5517.00 5517 98.8080 1 3092 1 chr1B.!!$F6 3091
2 TraesCS1B01G354800 chr1B 584778732 584780679 1947 False 2362.00 2362 88.6910 386 2369 1 chr1B.!!$F9 1983
3 TraesCS1B01G354800 chr1B 584603477 584605347 1870 False 2115.00 2115 87.2930 645 2531 1 chr1B.!!$F5 1886
4 TraesCS1B01G354800 chr1B 584761445 584763415 1970 False 2097.00 2097 86.1500 386 2400 1 chr1B.!!$F8 2014
5 TraesCS1B01G354800 chr1B 584653911 584655669 1758 False 2067.00 2067 87.9210 645 2437 1 chr1B.!!$F7 1792
6 TraesCS1B01G354800 chr1B 584566230 584567237 1007 False 1262.00 1262 89.4940 1525 2531 1 chr1B.!!$F3 1006
7 TraesCS1B01G354800 chr1B 584797095 584799471 2376 False 1193.50 1871 88.3525 386 2369 2 chr1B.!!$F11 1983
8 TraesCS1B01G354800 chr1B 584752173 584752728 555 False 391.00 440 91.9335 11 687 2 chr1B.!!$F10 676
9 TraesCS1B01G354800 chr1D 433060330 433062003 1673 False 2167.00 2167 89.8560 721 2449 1 chr1D.!!$F1 1728
10 TraesCS1B01G354800 chr1D 433091732 433094024 2292 False 1422.50 2442 90.2070 39 2378 2 chr1D.!!$F3 2339
11 TraesCS1B01G354800 chr1A 531366891 531368456 1565 False 2019.00 2019 89.8950 845 2449 1 chr1A.!!$F2 1604
12 TraesCS1B01G354800 chr1A 531561106 531563376 2270 False 1418.00 1847 89.5630 17 2402 2 chr1A.!!$F5 2385
13 TraesCS1B01G354800 chr1A 531510042 531514547 4505 False 1016.55 1936 87.8120 434 2402 2 chr1A.!!$F4 1968
14 TraesCS1B01G354800 chr1A 531501619 531502507 888 False 560.00 863 88.3185 11 876 2 chr1A.!!$F3 865
15 TraesCS1B01G354800 chr3B 647942590 647944507 1917 True 1600.00 1600 82.2650 384 2321 1 chr3B.!!$R3 1937
16 TraesCS1B01G354800 chr3B 647968832 647969914 1082 True 684.00 684 78.9790 384 1499 1 chr3B.!!$R4 1115
17 TraesCS1B01G354800 chr3A 628218888 628220798 1910 True 1559.00 1559 82.0000 384 2321 1 chr3A.!!$R1 1937
18 TraesCS1B01G354800 chr6A 616688597 616689241 644 True 325.00 542 88.4015 812 1518 2 chr6A.!!$R1 706

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2100 5249 7.361713 GCAATCAACCACTACTAATAAGTGCAA 60.362 37.037 0.0 0.0 42.47 4.08 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2912 6136 3.686916 AGTGTCCAGAGCTAGTTTTCC 57.313 47.619 0.0 0.0 0.0 3.13 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
2100 5249 7.361713 GCAATCAACCACTACTAATAAGTGCAA 60.362 37.037 0.0 0.0 42.47 4.08
2552 5776 4.515191 GTGCTCGCATTATTCCTGGATTTA 59.485 41.667 0.0 0.0 0.00 1.40
2592 5816 0.898320 CGTGTTCAGTGGGAGGAGAT 59.102 55.000 0.0 0.0 0.00 2.75
2596 5820 2.711009 TGTTCAGTGGGAGGAGATGTTT 59.289 45.455 0.0 0.0 0.00 2.83
2664 5888 7.763528 AGATGATATGTGTCAGTTCAGTCTTTC 59.236 37.037 0.0 0.0 0.00 2.62
2930 6154 4.202461 ACAATGGAAAACTAGCTCTGGACA 60.202 41.667 0.0 0.0 0.00 4.02
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
2100 5249 0.389296 TTGCTGCACTGCGTACGTAT 60.389 50.000 17.90 0.0 35.36 3.06
2552 5776 3.546020 CGCATCGCCGAAAATCTTACAAT 60.546 43.478 0.00 0.0 0.00 2.71
2611 5835 3.836365 TGACAAAGTCACCACTGATGA 57.164 42.857 0.00 0.0 37.67 2.92
2614 5838 4.422073 AGATTGACAAAGTCACCACTGA 57.578 40.909 0.00 0.0 42.60 3.41
2664 5888 2.288030 CCTACCGGTATAAGCACTTCCG 60.288 54.545 16.25 0.0 40.72 4.30
2847 6071 5.852282 AAAATCAGGGGGAAAATATGTCG 57.148 39.130 0.00 0.0 0.00 4.35
2892 6116 9.157104 GTTTTCCATTGTTTTAGGACTTTTCAA 57.843 29.630 0.00 0.0 0.00 2.69
2903 6127 7.001674 TCCAGAGCTAGTTTTCCATTGTTTTA 58.998 34.615 0.00 0.0 0.00 1.52
2912 6136 3.686916 AGTGTCCAGAGCTAGTTTTCC 57.313 47.619 0.00 0.0 0.00 3.13
3032 6256 7.530426 TCAGCATGCTCTCTAATATGTCTTA 57.470 36.000 19.68 0.0 34.76 2.10


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.