Multiple sequence alignment - TraesCS1B01G353300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G353300 chr1B 100.000 2675 0 0 1 2675 583563540 583560866 0.000000e+00 4940.0
1 TraesCS1B01G353300 chr7B 98.767 2676 32 1 1 2675 742950730 742948055 0.000000e+00 4758.0
2 TraesCS1B01G353300 chr7B 98.207 2677 45 3 1 2675 716782615 716785290 0.000000e+00 4674.0
3 TraesCS1B01G353300 chr2A 98.693 2677 33 2 1 2675 755478556 755481232 0.000000e+00 4748.0
4 TraesCS1B01G353300 chr2A 97.538 2234 52 3 443 2675 750455139 750452908 0.000000e+00 3818.0
5 TraesCS1B01G353300 chr2A 98.661 448 6 0 1 448 750477390 750476943 0.000000e+00 795.0
6 TraesCS1B01G353300 chr2A 97.790 362 8 0 2011 2372 642234908 642235269 2.260000e-175 625.0
7 TraesCS1B01G353300 chr2A 97.403 231 6 0 1 231 30190560 30190330 6.940000e-106 394.0
8 TraesCS1B01G353300 chr2A 100.000 138 0 0 855 992 107326062 107326199 3.420000e-64 255.0
9 TraesCS1B01G353300 chr2A 93.243 74 1 1 2240 2313 770093445 770093514 3.640000e-19 106.0
10 TraesCS1B01G353300 chr2A 100.000 46 0 0 17 62 86679534 86679489 4.740000e-13 86.1
11 TraesCS1B01G353300 chr2A 100.000 45 0 0 632 676 474337710 474337666 1.710000e-12 84.2
12 TraesCS1B01G353300 chr7A 98.655 2676 35 1 1 2675 60170759 60168084 0.000000e+00 4741.0
13 TraesCS1B01G353300 chr5A 98.655 2676 34 2 1 2675 420183711 420186385 0.000000e+00 4741.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G353300 chr1B 583560866 583563540 2674 True 4940 4940 100.000 1 2675 1 chr1B.!!$R1 2674
1 TraesCS1B01G353300 chr7B 742948055 742950730 2675 True 4758 4758 98.767 1 2675 1 chr7B.!!$R1 2674
2 TraesCS1B01G353300 chr7B 716782615 716785290 2675 False 4674 4674 98.207 1 2675 1 chr7B.!!$F1 2674
3 TraesCS1B01G353300 chr2A 755478556 755481232 2676 False 4748 4748 98.693 1 2675 1 chr2A.!!$F3 2674
4 TraesCS1B01G353300 chr2A 750452908 750455139 2231 True 3818 3818 97.538 443 2675 1 chr2A.!!$R4 2232
5 TraesCS1B01G353300 chr7A 60168084 60170759 2675 True 4741 4741 98.655 1 2675 1 chr7A.!!$R1 2674
6 TraesCS1B01G353300 chr5A 420183711 420186385 2674 False 4741 4741 98.655 1 2675 1 chr5A.!!$F1 2674

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
545 546 4.033776 CTCACGGCCACCCCACAT 62.034 66.667 2.24 0.0 0.0 3.21 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2232 2236 0.035317 TGAGTCGCAGCATCAAGGTT 59.965 50.0 0.0 0.0 0.0 3.5 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
271 272 4.981806 ACAAACAAGTTCAAAGCTAGCA 57.018 36.364 18.83 0.00 0.00 3.49
545 546 4.033776 CTCACGGCCACCCCACAT 62.034 66.667 2.24 0.00 0.00 3.21
1031 1034 1.447489 CCAGAGCTGCGGAACTCAG 60.447 63.158 10.09 1.35 45.11 3.35
1067 1070 9.574516 AGAAAGTAGAATGACCAACTTTTACAT 57.425 29.630 0.00 0.00 41.08 2.29
1279 1282 2.417379 GGAGATCTTGTCAAGCGCACTA 60.417 50.000 11.47 0.00 0.00 2.74
1360 1363 6.590656 TGGGAGTACCTATTGATGGAAAAT 57.409 37.500 0.00 0.00 41.11 1.82
1382 1385 1.469251 GGCTCTAAGCGATCACGAACA 60.469 52.381 0.00 0.00 43.62 3.18
1485 1488 3.144125 TGGATAGCCTGGTTCCTATAGGT 59.856 47.826 18.51 0.00 34.06 3.08
1491 1494 2.662866 CTGGTTCCTATAGGTCGTGGA 58.337 52.381 18.51 0.00 36.34 4.02
1637 1640 3.510388 TGTTGCGATTGGACAAAAACA 57.490 38.095 0.00 0.00 0.00 2.83
1672 1675 8.149647 TGGCACAATTAGTTCAAATTCTTTCAT 58.850 29.630 0.00 0.00 31.92 2.57
1797 1800 2.183478 TCCGCGATAATGGAATGCAT 57.817 45.000 8.23 0.00 0.00 3.96
1840 1844 0.881118 AAGTAAACAGGCGGTGCATG 59.119 50.000 1.47 1.47 46.22 4.06
2230 2234 0.603065 GCCTTCGCTCAATTTGGGTT 59.397 50.000 0.00 0.00 0.00 4.11
2232 2236 2.230266 GCCTTCGCTCAATTTGGGTTAA 59.770 45.455 0.00 0.00 0.00 2.01
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
107 108 6.556116 TCCTATACTTCCAATAACCCACTACC 59.444 42.308 0.00 0.0 0.00 3.18
271 272 6.049790 GGAATCTACCGTTCTTTATGCTCTT 58.950 40.000 0.00 0.0 0.00 2.85
832 835 3.949885 TTCGCGGTCCTGCTCCCTA 62.950 63.158 6.13 0.0 0.00 3.53
1031 1034 8.915036 TGGTCATTCTACTTTCTAATAGAGTCC 58.085 37.037 0.00 0.0 0.00 3.85
1067 1070 5.355071 CCGATCTCATCCACTTGAAAATTCA 59.645 40.000 0.00 0.0 34.92 2.57
1279 1282 4.712476 GCAGGAACATCCACAATAGATCT 58.288 43.478 0.00 0.0 39.61 2.75
1360 1363 1.035385 TCGTGATCGCTTAGAGCCCA 61.035 55.000 4.48 0.0 38.18 5.36
1382 1385 2.284417 GCTTTCACTTCGACACGTCTTT 59.716 45.455 0.00 0.0 0.00 2.52
1491 1494 4.403432 TCCCCGATTATAAGTTCTCGTTGT 59.597 41.667 5.70 0.0 0.00 3.32
1637 1640 2.037251 ACTAATTGTGCCACAGTCGAGT 59.963 45.455 0.00 0.0 0.00 4.18
1961 1965 0.169672 GTAACGCAGTCGAGCTACCA 59.830 55.000 0.00 0.0 45.00 3.25
2230 2234 2.289382 TGAGTCGCAGCATCAAGGTTTA 60.289 45.455 0.00 0.0 0.00 2.01
2232 2236 0.035317 TGAGTCGCAGCATCAAGGTT 59.965 50.000 0.00 0.0 0.00 3.50


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.