Multiple sequence alignment - TraesCS1B01G353200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G353200 chr1B 100.000 2681 0 0 1 2681 583562692 583560012 0 4951
1 TraesCS1B01G353200 chr7A 97.928 2703 32 8 1 2681 60083793 60086493 0 4660
2 TraesCS1B01G353200 chr7A 97.780 2703 37 7 1 2681 60169911 60167210 0 4638
3 TraesCS1B01G353200 chr7B 97.891 2703 34 7 1 2681 742949882 742947181 0 4654
4 TraesCS1B01G353200 chr7B 97.632 2703 41 7 1 2681 716783463 716786164 0 4615
5 TraesCS1B01G353200 chr7B 95.723 1099 31 7 1586 2681 33501221 33502306 0 1755
6 TraesCS1B01G353200 chr5A 97.817 2703 36 9 1 2681 16543410 16546111 0 4643
7 TraesCS1B01G353200 chr5A 97.706 2703 38 8 1 2681 420184559 420187259 0 4626
8 TraesCS1B01G353200 chr2A 97.407 2622 45 7 1 2600 755479405 755482025 0 4444
9 TraesCS1B01G353200 chr2D 95.949 2691 94 9 2 2681 291772476 291775162 0 4351
10 TraesCS1B01G353200 chr2D 96.222 2435 61 13 1 2429 39655509 39657918 0 3958
11 TraesCS1B01G353200 chrUn 96.789 1121 14 6 1582 2681 417899046 417900165 0 1851
12 TraesCS1B01G353200 chr6B 96.325 1034 32 4 1652 2681 388227635 388226604 0 1694


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G353200 chr1B 583560012 583562692 2680 True 4951 4951 100.000 1 2681 1 chr1B.!!$R1 2680
1 TraesCS1B01G353200 chr7A 60083793 60086493 2700 False 4660 4660 97.928 1 2681 1 chr7A.!!$F1 2680
2 TraesCS1B01G353200 chr7A 60167210 60169911 2701 True 4638 4638 97.780 1 2681 1 chr7A.!!$R1 2680
3 TraesCS1B01G353200 chr7B 742947181 742949882 2701 True 4654 4654 97.891 1 2681 1 chr7B.!!$R1 2680
4 TraesCS1B01G353200 chr7B 716783463 716786164 2701 False 4615 4615 97.632 1 2681 1 chr7B.!!$F2 2680
5 TraesCS1B01G353200 chr7B 33501221 33502306 1085 False 1755 1755 95.723 1586 2681 1 chr7B.!!$F1 1095
6 TraesCS1B01G353200 chr5A 16543410 16546111 2701 False 4643 4643 97.817 1 2681 1 chr5A.!!$F1 2680
7 TraesCS1B01G353200 chr5A 420184559 420187259 2700 False 4626 4626 97.706 1 2681 1 chr5A.!!$F2 2680
8 TraesCS1B01G353200 chr2A 755479405 755482025 2620 False 4444 4444 97.407 1 2600 1 chr2A.!!$F1 2599
9 TraesCS1B01G353200 chr2D 291772476 291775162 2686 False 4351 4351 95.949 2 2681 1 chr2D.!!$F2 2679
10 TraesCS1B01G353200 chr2D 39655509 39657918 2409 False 3958 3958 96.222 1 2429 1 chr2D.!!$F1 2428
11 TraesCS1B01G353200 chrUn 417899046 417900165 1119 False 1851 1851 96.789 1582 2681 1 chrUn.!!$F1 1099
12 TraesCS1B01G353200 chr6B 388226604 388227635 1031 True 1694 1694 96.325 1652 2681 1 chr6B.!!$R1 1029

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
992 994 0.881118 AAGTAAACAGGCGGTGCATG 59.119 50.0 1.47 1.47 46.22 4.06 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2502 2544 0.177836 TGGACGTCGATCCGGTACTA 59.822 55.0 9.92 0.0 42.24 1.82 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
183 184 1.447489 CCAGAGCTGCGGAACTCAG 60.447 63.158 10.09 1.35 45.11 3.35
219 220 9.574516 AGAAAGTAGAATGACCAACTTTTACAT 57.425 29.630 0.00 0.00 41.08 2.29
512 513 6.590656 TGGGAGTACCTATTGATGGAAAAT 57.409 37.500 0.00 0.00 41.11 1.82
534 535 1.469251 GGCTCTAAGCGATCACGAACA 60.469 52.381 0.00 0.00 43.62 3.18
637 638 3.144125 TGGATAGCCTGGTTCCTATAGGT 59.856 47.826 18.51 0.00 34.06 3.08
643 644 2.662866 CTGGTTCCTATAGGTCGTGGA 58.337 52.381 18.51 0.00 36.34 4.02
789 790 3.510388 TGTTGCGATTGGACAAAAACA 57.490 38.095 0.00 0.00 0.00 2.83
824 825 8.149647 TGGCACAATTAGTTCAAATTCTTTCAT 58.850 29.630 0.00 0.00 31.92 2.57
949 950 2.183478 TCCGCGATAATGGAATGCAT 57.817 45.000 8.23 0.00 0.00 3.96
992 994 0.881118 AAGTAAACAGGCGGTGCATG 59.119 50.000 1.47 1.47 46.22 4.06
1382 1384 0.603065 GCCTTCGCTCAATTTGGGTT 59.397 50.000 0.00 0.00 0.00 4.11
1384 1386 2.230266 GCCTTCGCTCAATTTGGGTTAA 59.770 45.455 0.00 0.00 0.00 2.01
1875 1878 3.051341 TCCAGTAGTTCAGGATACCCCAT 60.051 47.826 0.00 0.00 37.41 4.00
1908 1911 1.914764 GTTGACGGACCCCCTACCA 60.915 63.158 0.00 0.00 0.00 3.25
2021 2062 4.218852 TGGTCCGTCCCAATATTTGAAAAC 59.781 41.667 0.00 0.00 34.77 2.43
2047 2088 0.539669 GGTGCAGGCCCAAGTACTTT 60.540 55.000 5.07 0.00 0.00 2.66
2081 2122 5.360714 ACAAGAAATCCAAGAAAGAACAGCA 59.639 36.000 0.00 0.00 0.00 4.41
2176 2217 2.164219 GCTGCTACAATTGCTTTAGCCA 59.836 45.455 18.65 9.66 37.95 4.75
2653 2695 6.628919 ACCCGCATGTTTAGATTATTTACC 57.371 37.500 0.00 0.00 0.00 2.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
183 184 8.915036 TGGTCATTCTACTTTCTAATAGAGTCC 58.085 37.037 0.00 0.0 0.00 3.85
219 220 5.355071 CCGATCTCATCCACTTGAAAATTCA 59.645 40.000 0.00 0.0 34.92 2.57
512 513 1.035385 TCGTGATCGCTTAGAGCCCA 61.035 55.000 4.48 0.0 38.18 5.36
534 535 2.284417 GCTTTCACTTCGACACGTCTTT 59.716 45.455 0.00 0.0 0.00 2.52
643 644 4.403432 TCCCCGATTATAAGTTCTCGTTGT 59.597 41.667 5.70 0.0 0.00 3.32
789 790 2.037251 ACTAATTGTGCCACAGTCGAGT 59.963 45.455 0.00 0.0 0.00 4.18
1113 1115 0.169672 GTAACGCAGTCGAGCTACCA 59.830 55.000 0.00 0.0 45.00 3.25
1382 1384 2.289382 TGAGTCGCAGCATCAAGGTTTA 60.289 45.455 0.00 0.0 0.00 2.01
1384 1386 0.035317 TGAGTCGCAGCATCAAGGTT 59.965 50.000 0.00 0.0 0.00 3.50
2005 2042 7.341769 CACCTCCATAGTTTTCAAATATTGGGA 59.658 37.037 0.00 0.0 0.00 4.37
2021 2062 1.925285 TTGGGCCTGCACCTCCATAG 61.925 60.000 4.53 0.0 0.00 2.23
2047 2088 7.764141 TCTTGGATTTCTTGTTGATGATTCA 57.236 32.000 0.00 0.0 0.00 2.57
2081 2122 6.364976 CACTTTTCTTGTCACGTTTTTCCTTT 59.635 34.615 0.00 0.0 0.00 3.11
2176 2217 2.034878 TCCAATATCGACAGCAGCTCT 58.965 47.619 0.00 0.0 0.00 4.09
2189 2230 5.422214 AGAACTGAGGACGTTTCCAATAT 57.578 39.130 0.00 0.0 45.72 1.28
2277 2318 2.080286 TAGCTTCGGTGAGAGCAAAC 57.920 50.000 0.00 0.0 0.00 2.93
2502 2544 0.177836 TGGACGTCGATCCGGTACTA 59.822 55.000 9.92 0.0 42.24 1.82
2653 2695 3.550842 CCGAAGAAAAAGTGAAAGGGCAG 60.551 47.826 0.00 0.0 0.00 4.85


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.