Multiple sequence alignment - TraesCS1B01G352900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G352900 chr1B 100.000 3160 0 0 1 3160 583548104 583551263 0 5836
1 TraesCS1B01G352900 chr1B 96.783 3171 81 8 1 3160 49787126 49783966 0 5271
2 TraesCS1B01G352900 chr1B 96.603 3179 83 10 1 3160 49815629 49818801 0 5249
3 TraesCS1B01G352900 chr7B 98.577 3162 43 1 1 3160 716798045 716794884 0 5589
4 TraesCS1B01G352900 chr7B 98.134 3161 47 4 1 3160 742935285 742938434 0 5500
5 TraesCS1B01G352900 chr7B 96.540 3179 89 10 1 3160 47217231 47220407 0 5241
6 TraesCS1B01G352900 chr7B 96.059 3172 92 8 1 3160 139621809 139618659 0 5134
7 TraesCS1B01G352900 chr6B 98.545 3161 40 2 1 3160 128892184 128889029 0 5578
8 TraesCS1B01G352900 chr5B 98.481 3161 45 3 1 3160 713115167 713112009 0 5568
9 TraesCS1B01G352900 chr5B 98.165 3161 56 2 1 3160 713093560 713096719 0 5515
10 TraesCS1B01G352900 chr5B 98.107 2271 34 4 1 2269 127821200 127818937 0 3947
11 TraesCS1B01G352900 chr7A 98.179 2252 35 5 913 3160 60097493 60095244 0 3927


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G352900 chr1B 583548104 583551263 3159 False 5836 5836 100.000 1 3160 1 chr1B.!!$F2 3159
1 TraesCS1B01G352900 chr1B 49783966 49787126 3160 True 5271 5271 96.783 1 3160 1 chr1B.!!$R1 3159
2 TraesCS1B01G352900 chr1B 49815629 49818801 3172 False 5249 5249 96.603 1 3160 1 chr1B.!!$F1 3159
3 TraesCS1B01G352900 chr7B 716794884 716798045 3161 True 5589 5589 98.577 1 3160 1 chr7B.!!$R2 3159
4 TraesCS1B01G352900 chr7B 742935285 742938434 3149 False 5500 5500 98.134 1 3160 1 chr7B.!!$F2 3159
5 TraesCS1B01G352900 chr7B 47217231 47220407 3176 False 5241 5241 96.540 1 3160 1 chr7B.!!$F1 3159
6 TraesCS1B01G352900 chr7B 139618659 139621809 3150 True 5134 5134 96.059 1 3160 1 chr7B.!!$R1 3159
7 TraesCS1B01G352900 chr6B 128889029 128892184 3155 True 5578 5578 98.545 1 3160 1 chr6B.!!$R1 3159
8 TraesCS1B01G352900 chr5B 713112009 713115167 3158 True 5568 5568 98.481 1 3160 1 chr5B.!!$R2 3159
9 TraesCS1B01G352900 chr5B 713093560 713096719 3159 False 5515 5515 98.165 1 3160 1 chr5B.!!$F1 3159
10 TraesCS1B01G352900 chr5B 127818937 127821200 2263 True 3947 3947 98.107 1 2269 1 chr5B.!!$R1 2268
11 TraesCS1B01G352900 chr7A 60095244 60097493 2249 True 3927 3927 98.179 913 3160 1 chr7A.!!$R1 2247

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
974 986 1.502231 TCAAAAGTGAGCGAGCAGAC 58.498 50.0 0.0 0.0 0.0 3.51 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2858 2883 1.011451 GTGAGCGAGACCAAGACAGC 61.011 60.0 0.0 0.0 0.0 4.4 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
215 221 3.197983 AGTCCACGGCTTAGCTTAATTCT 59.802 43.478 3.59 0.0 0.00 2.40
356 362 8.010733 CAAATGATTGTAATATGACAACCCCT 57.989 34.615 7.85 0.0 41.93 4.79
812 818 7.521871 AAGAGAATGTTGCTCTTCAGAAAAT 57.478 32.000 0.00 0.0 46.75 1.82
974 986 1.502231 TCAAAAGTGAGCGAGCAGAC 58.498 50.000 0.00 0.0 0.00 3.51
1073 1085 7.094592 TGCTATTACAACGAATCAACCAATTCA 60.095 33.333 0.00 0.0 35.75 2.57
1483 1502 4.160252 TCTTGTATATGCTGCTCACTGTCA 59.840 41.667 0.00 0.0 0.00 3.58
1619 1641 4.969484 ACGAACAAATAGGTGGTCTTTCT 58.031 39.130 0.00 0.0 32.72 2.52
1980 2004 2.108250 AGTGGGTTTGCTTGGACTATGT 59.892 45.455 0.00 0.0 0.00 2.29
2056 2080 4.058817 GTTCTAGCATTAATCGGTCTGGG 58.941 47.826 0.00 0.0 0.00 4.45
2269 2293 4.537135 TGTGTTTGGAGAGGTGTAGATC 57.463 45.455 0.00 0.0 0.00 2.75
2496 2520 6.808212 CGACCAAATTGAACAAATGATAGCTT 59.192 34.615 0.00 0.0 0.00 3.74
2616 2640 2.306255 ATCGCCCTTACGCGGTCAAT 62.306 55.000 12.47 0.0 43.50 2.57
2620 2644 1.663695 CCCTTACGCGGTCAATGAAT 58.336 50.000 12.47 0.0 0.00 2.57
2858 2883 4.742201 CGCCACTCCACGTCTGGG 62.742 72.222 0.00 0.0 38.25 4.45
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
8 9 2.906389 AGTCCTAGCCATTCTCACAACA 59.094 45.455 0.00 0.00 0.00 3.33
58 64 3.703420 CCTTGCGCTACTCGTAAAGTAT 58.297 45.455 9.73 0.00 41.96 2.12
356 362 1.204146 CACAAAGGCTAGCTCCCCTA 58.796 55.000 15.72 0.00 0.00 3.53
812 818 0.101759 GACGAAGGCCACTATACGCA 59.898 55.000 5.01 0.00 0.00 5.24
1073 1085 3.450096 GGGAAGACGGGAACACTTACTAT 59.550 47.826 0.00 0.00 30.87 2.12
1506 1528 3.633065 CCACCTCCCTTTTTCGTAACAAA 59.367 43.478 0.00 0.00 0.00 2.83
2047 2071 2.662866 CTACACCTAATCCCAGACCGA 58.337 52.381 0.00 0.00 0.00 4.69
2056 2080 7.607250 AGCTTGTGATATAGCTACACCTAATC 58.393 38.462 9.71 2.24 45.46 1.75
2269 2293 1.676529 TCTTCTCGGCTGGAATCTACG 59.323 52.381 0.00 0.00 0.00 3.51
2496 2520 7.959658 ATTCCCAATGAACAACATGATCTTA 57.040 32.000 0.00 0.00 39.39 2.10
2616 2640 7.558161 CAGTCCTTGCATTAGTATGAATTCA 57.442 36.000 11.26 11.26 33.37 2.57
2858 2883 1.011451 GTGAGCGAGACCAAGACAGC 61.011 60.000 0.00 0.00 0.00 4.40


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.