Multiple sequence alignment - TraesCS1B01G342900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G342900 chr1B 100.000 2264 0 0 1 2264 571422403 571420140 0.000000e+00 4181
1 TraesCS1B01G342900 chr6B 97.918 2017 42 0 1 2017 181111563 181109547 0.000000e+00 3493
2 TraesCS1B01G342900 chr5B 97.471 2017 49 1 1 2017 506965544 506967558 0.000000e+00 3441
3 TraesCS1B01G342900 chr5B 94.958 238 11 1 2027 2264 535136300 535136536 2.750000e-99 372
4 TraesCS1B01G342900 chr5B 96.078 204 8 0 2061 2264 709184650 709184447 1.300000e-87 333
5 TraesCS1B01G342900 chr4B 97.372 2017 47 4 1 2017 551060038 551062048 0.000000e+00 3426
6 TraesCS1B01G342900 chr4B 95.082 244 11 1 2021 2264 551062197 551062439 1.270000e-102 383
7 TraesCS1B01G342900 chr2B 97.323 2017 53 1 1 2017 454449226 454451241 0.000000e+00 3424
8 TraesCS1B01G342900 chr2B 97.225 2018 54 2 1 2017 549352846 549354862 0.000000e+00 3415
9 TraesCS1B01G342900 chr2B 97.224 2017 55 1 1 2017 454473359 454475374 0.000000e+00 3413
10 TraesCS1B01G342900 chr3B 97.081 2021 55 2 1 2017 604266042 604264022 0.000000e+00 3402
11 TraesCS1B01G342900 chr3B 95.102 245 12 0 2020 2264 760825726 760825970 9.810000e-104 387
12 TraesCS1B01G342900 chr3B 94.694 245 13 0 2020 2264 420918966 420918722 4.560000e-102 381
13 TraesCS1B01G342900 chr4D 94.121 2007 111 7 1 2003 470196637 470194634 0.000000e+00 3046
14 TraesCS1B01G342900 chr2D 94.094 1981 113 4 1 1979 619853632 619855610 0.000000e+00 3007
15 TraesCS1B01G342900 chr6A 92.308 247 19 0 2018 2264 23006823 23007069 3.580000e-93 351
16 TraesCS1B01G342900 chr2A 92.245 245 16 3 2021 2264 770002998 770002756 5.990000e-91 344
17 TraesCS1B01G342900 chr6D 90.726 248 17 6 2020 2264 377214337 377214581 2.170000e-85 326
18 TraesCS1B01G342900 chr7D 88.755 249 19 8 2020 2264 528563412 528563655 1.700000e-76 296


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G342900 chr1B 571420140 571422403 2263 True 4181.0 4181 100.000 1 2264 1 chr1B.!!$R1 2263
1 TraesCS1B01G342900 chr6B 181109547 181111563 2016 True 3493.0 3493 97.918 1 2017 1 chr6B.!!$R1 2016
2 TraesCS1B01G342900 chr5B 506965544 506967558 2014 False 3441.0 3441 97.471 1 2017 1 chr5B.!!$F1 2016
3 TraesCS1B01G342900 chr4B 551060038 551062439 2401 False 1904.5 3426 96.227 1 2264 2 chr4B.!!$F1 2263
4 TraesCS1B01G342900 chr2B 454449226 454451241 2015 False 3424.0 3424 97.323 1 2017 1 chr2B.!!$F1 2016
5 TraesCS1B01G342900 chr2B 549352846 549354862 2016 False 3415.0 3415 97.225 1 2017 1 chr2B.!!$F3 2016
6 TraesCS1B01G342900 chr2B 454473359 454475374 2015 False 3413.0 3413 97.224 1 2017 1 chr2B.!!$F2 2016
7 TraesCS1B01G342900 chr3B 604264022 604266042 2020 True 3402.0 3402 97.081 1 2017 1 chr3B.!!$R2 2016
8 TraesCS1B01G342900 chr4D 470194634 470196637 2003 True 3046.0 3046 94.121 1 2003 1 chr4D.!!$R1 2002
9 TraesCS1B01G342900 chr2D 619853632 619855610 1978 False 3007.0 3007 94.094 1 1979 1 chr2D.!!$F1 1978

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
211 212 2.564504 GGTAGGTCTTACGGTGGAGTTT 59.435 50.0 0.0 0.0 32.79 2.66 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1932 1936 0.416231 TAGGGTCCAGCAACCTACCT 59.584 55.0 3.36 0.0 39.42 3.08 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
211 212 2.564504 GGTAGGTCTTACGGTGGAGTTT 59.435 50.000 0.00 0.0 32.79 2.66
324 325 4.504858 GGGTGAGAAACATGAACGTATCT 58.495 43.478 0.00 0.0 0.00 1.98
503 504 7.882791 GGGAAGAAGAAGAAAGAAGAGATTTCT 59.117 37.037 0.00 0.0 46.37 2.52
565 566 4.220602 AGCAATTTGGTAGTGGTCATTTCC 59.779 41.667 0.00 0.0 0.00 3.13
1438 1440 2.803956 CGGCTGTTCGAAGAAAGGTTTA 59.196 45.455 0.00 0.0 45.90 2.01
1460 1462 0.546267 AGAGGCTTGGAGGAAGAGCA 60.546 55.000 0.00 0.0 38.14 4.26
1544 1546 1.304952 CTCGTGAGGAGGAGAGGGT 59.695 63.158 0.00 0.0 39.22 4.34
1633 1635 2.460918 CCCGTATGACTCAGTAAAGCG 58.539 52.381 0.00 0.0 0.00 4.68
2017 2025 3.783478 AAACCAAAACCGCTGGCGC 62.783 57.895 9.63 0.0 37.48 6.53
2057 2210 1.214367 GGCGTTTCTCGTCACAGAAA 58.786 50.000 0.00 0.0 44.22 2.52
2063 2216 3.944422 TTCTCGTCACAGAAACTTTGC 57.056 42.857 0.00 0.0 29.01 3.68
2158 2311 0.322906 CCTCCTCTCCCCTGTTTTGC 60.323 60.000 0.00 0.0 0.00 3.68
2171 2324 3.091545 CTGTTTTGCCCCATATGTGTCT 58.908 45.455 1.24 0.0 0.00 3.41
2173 2326 4.865905 TGTTTTGCCCCATATGTGTCTAT 58.134 39.130 1.24 0.0 0.00 1.98
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
503 504 4.038883 CAGCTAGATCATCCATGTCACTCA 59.961 45.833 0.00 0.00 0.00 3.41
539 540 2.811431 TGACCACTACCAAATTGCTTCG 59.189 45.455 0.00 0.00 0.00 3.79
565 566 0.821711 TTGTTTTCCGGTGGCTCCAG 60.822 55.000 0.00 0.00 35.57 3.86
736 737 0.684805 CTAGTCCTTCCTCCACGGCT 60.685 60.000 0.00 0.00 0.00 5.52
1071 1073 2.655090 TCACCTTGTCCAAAGATGCA 57.345 45.000 0.00 0.00 0.00 3.96
1438 1440 2.554124 GCTCTTCCTCCAAGCCTCTTTT 60.554 50.000 0.00 0.00 31.26 2.27
1460 1462 4.764172 CTCCATCCTCTCTTTTTGACGAT 58.236 43.478 0.00 0.00 0.00 3.73
1849 1851 3.438360 CACTTTTCTTCACAGCACAACC 58.562 45.455 0.00 0.00 0.00 3.77
1932 1936 0.416231 TAGGGTCCAGCAACCTACCT 59.584 55.000 3.36 0.00 39.42 3.08
2035 2188 1.284982 CTGTGACGAGAAACGCCAGG 61.285 60.000 0.00 0.00 46.94 4.45
2158 2311 5.620206 TGCTAACAATAGACACATATGGGG 58.380 41.667 10.35 2.41 0.00 4.96
2222 2375 5.122239 TGAGTTGAGTTATGTATGTGCTTGC 59.878 40.000 0.00 0.00 0.00 4.01


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.