Multiple sequence alignment - TraesCS1B01G329100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G329100 chr1B 100.000 2528 0 0 1 2528 555087239 555089766 0.000000e+00 4669.0
1 TraesCS1B01G329100 chr1B 99.051 2529 22 2 1 2528 555028816 555031343 0.000000e+00 4536.0
2 TraesCS1B01G329100 chr1B 92.649 2503 141 12 56 2524 555067914 555070407 0.000000e+00 3563.0
3 TraesCS1B01G329100 chr1B 92.649 2503 141 12 56 2524 555073257 555075750 0.000000e+00 3563.0
4 TraesCS1B01G329100 chr1B 92.259 2506 152 11 56 2528 555062562 555065058 0.000000e+00 3515.0
5 TraesCS1B01G329100 chr1B 92.096 2505 156 10 56 2528 555014636 555017130 0.000000e+00 3491.0
6 TraesCS1B01G329100 chr1B 91.943 2507 159 12 56 2528 555009280 555011777 0.000000e+00 3470.0
7 TraesCS1B01G329100 chr1B 86.047 1548 146 28 510 2013 555122145 555123666 0.000000e+00 1598.0
8 TraesCS1B01G329100 chr1B 86.589 343 18 10 666 984 554995398 554995736 1.110000e-93 353.0
9 TraesCS1B01G329100 chr1B 91.286 241 16 3 745 984 555047838 555048074 8.720000e-85 324.0
10 TraesCS1B01G329100 chr1B 100.000 56 0 0 1 56 555005917 555005972 1.240000e-18 104.0
11 TraesCS1B01G329100 chr1B 100.000 56 0 0 1 56 555014542 555014597 1.240000e-18 104.0
12 TraesCS1B01G329100 chr1B 100.000 56 0 0 1 56 555059144 555059199 1.240000e-18 104.0
13 TraesCS1B01G329100 chr1B 100.000 56 0 0 1 56 555062468 555062523 1.240000e-18 104.0
14 TraesCS1B01G329100 chr1B 98.214 56 1 0 1 56 555009186 555009241 5.760000e-17 99.0
15 TraesCS1B01G329100 chr1B 98.182 55 1 0 1 55 555067826 555067880 2.070000e-16 97.1
16 TraesCS1B01G329100 chr1B 98.182 55 1 0 1 55 555073169 555073223 2.070000e-16 97.1
17 TraesCS1B01G329100 chr1D 89.058 1974 178 22 56 2013 411582443 411584394 0.000000e+00 2414.0
18 TraesCS1B01G329100 chr1D 89.844 896 71 12 56 942 411703365 411704249 0.000000e+00 1133.0
19 TraesCS1B01G329100 chr1A 89.856 1597 153 5 927 2522 508302667 508304255 0.000000e+00 2043.0
20 TraesCS1B01G329100 chr1A 89.731 1597 155 5 927 2522 508334562 508336150 0.000000e+00 2032.0
21 TraesCS1B01G329100 chr1A 89.487 1598 157 7 927 2522 508275638 508277226 0.000000e+00 2010.0
22 TraesCS1B01G329100 chr1A 96.364 55 2 0 3 57 508158048 508158102 9.630000e-15 91.6
23 TraesCS1B01G329100 chrUn 92.518 695 46 2 59 747 11272640 11271946 0.000000e+00 990.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G329100 chr1B 555087239 555089766 2527 False 4669.0 4669 100.000000 1 2528 1 chr1B.!!$F4 2527
1 TraesCS1B01G329100 chr1B 555028816 555031343 2527 False 4536.0 4536 99.051000 1 2528 1 chr1B.!!$F2 2527
2 TraesCS1B01G329100 chr1B 555122145 555123666 1521 False 1598.0 1598 86.047000 510 2013 1 chr1B.!!$F5 1503
3 TraesCS1B01G329100 chr1B 555059144 555075750 16606 False 1577.6 3563 96.274429 1 2528 7 chr1B.!!$F7 2527
4 TraesCS1B01G329100 chr1B 555005917 555017130 11213 False 1453.6 3491 96.450600 1 2528 5 chr1B.!!$F6 2527
5 TraesCS1B01G329100 chr1D 411582443 411584394 1951 False 2414.0 2414 89.058000 56 2013 1 chr1D.!!$F1 1957
6 TraesCS1B01G329100 chr1D 411703365 411704249 884 False 1133.0 1133 89.844000 56 942 1 chr1D.!!$F2 886
7 TraesCS1B01G329100 chr1A 508302667 508304255 1588 False 2043.0 2043 89.856000 927 2522 1 chr1A.!!$F3 1595
8 TraesCS1B01G329100 chr1A 508334562 508336150 1588 False 2032.0 2032 89.731000 927 2522 1 chr1A.!!$F4 1595
9 TraesCS1B01G329100 chr1A 508275638 508277226 1588 False 2010.0 2010 89.487000 927 2522 1 chr1A.!!$F2 1595
10 TraesCS1B01G329100 chrUn 11271946 11272640 694 True 990.0 990 92.518000 59 747 1 chrUn.!!$R1 688

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
667 9390 6.013379 ACCAATCTCATCTTCTCCACTGTTAA 60.013 38.462 0.0 0.0 0.0 2.01 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2179 21654 1.370064 GTACACCGTCAGCACCCTT 59.63 57.895 0.0 0.0 0.0 3.95 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
667 9390 6.013379 ACCAATCTCATCTTCTCCACTGTTAA 60.013 38.462 0.00 0.0 0.0 2.01
987 9757 6.783708 ACTAAGTCAGCAAGCTAGTAGATT 57.216 37.500 0.00 0.0 0.0 2.40
2179 21654 3.680786 CAGGGAGCGACGTGGTGA 61.681 66.667 0.00 0.0 0.0 4.02
2180 21655 2.915659 AGGGAGCGACGTGGTGAA 60.916 61.111 0.00 0.0 0.0 3.18
2296 21771 1.639635 ATCTGGATGTGGTGCTCCCC 61.640 60.000 1.59 0.0 0.0 4.81
2308 21783 2.572284 CTCCCCTTCCGTCGTGAC 59.428 66.667 0.00 0.0 0.0 3.67
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
987 9757 8.912988 GTTTTGGTCTCCATGGATTAAATATGA 58.087 33.333 16.63 3.17 31.53 2.15
1570 10340 2.249309 AATACACGAAGGGACCCTCT 57.751 50.000 15.27 4.02 30.89 3.69
1940 21415 4.656041 CGATCTGAAGTCTTGCAATTTCC 58.344 43.478 0.00 0.00 0.00 3.13
2179 21654 1.370064 GTACACCGTCAGCACCCTT 59.630 57.895 0.00 0.00 0.00 3.95
2180 21655 2.580601 GGTACACCGTCAGCACCCT 61.581 63.158 0.00 0.00 0.00 4.34


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.