Multiple sequence alignment - TraesCS1B01G319800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G319800 chr1B 100.000 2372 0 0 1 2372 543842642 543845013 0.000000e+00 4381
1 TraesCS1B01G319800 chr4B 99.452 2372 10 2 1 2372 519325248 519327616 0.000000e+00 4305
2 TraesCS1B01G319800 chr3A 99.157 2373 15 4 1 2372 302927189 302929557 0.000000e+00 4266
3 TraesCS1B01G319800 chr4A 98.441 2373 34 3 1 2372 650160622 650158252 0.000000e+00 4174
4 TraesCS1B01G319800 chr4A 90.009 1151 73 22 635 1771 584730642 584731764 0.000000e+00 1450
5 TraesCS1B01G319800 chr4A 89.391 1150 76 22 635 1771 584684280 584683164 0.000000e+00 1406
6 TraesCS1B01G319800 chr4A 91.304 207 16 2 1811 2016 584683167 584682962 4.990000e-72 281
7 TraesCS1B01G319800 chr2B 92.851 2406 118 21 1 2372 58919302 58921687 0.000000e+00 3441
8 TraesCS1B01G319800 chr2B 90.909 913 60 13 1 903 52109910 52109011 0.000000e+00 1205
9 TraesCS1B01G319800 chr2B 91.597 357 20 4 2017 2372 52108264 52107917 3.540000e-133 484
10 TraesCS1B01G319800 chr2B 85.906 149 20 1 2132 2280 747666844 747666991 8.780000e-35 158
11 TraesCS1B01G319800 chr3B 94.255 1845 75 15 541 2372 803142530 803140704 0.000000e+00 2791
12 TraesCS1B01G319800 chr3B 93.439 503 30 1 44 543 803186546 803186044 0.000000e+00 743
13 TraesCS1B01G319800 chr2A 93.939 1815 79 13 1 1794 120507002 120508806 0.000000e+00 2713
14 TraesCS1B01G319800 chr1A 91.314 1796 110 23 1 1770 516720272 516718497 0.000000e+00 2410
15 TraesCS1B01G319800 chr1A 91.209 273 15 2 2100 2372 516718282 516718019 1.730000e-96 363
16 TraesCS1B01G319800 chr7B 90.000 1800 133 21 1 1771 489410052 489411833 0.000000e+00 2283
17 TraesCS1B01G319800 chr7B 93.557 357 22 1 2017 2372 489411993 489412349 4.490000e-147 531
18 TraesCS1B01G319800 chr7B 93.204 206 14 0 1811 2016 489411830 489412035 1.070000e-78 303
19 TraesCS1B01G319800 chr3D 97.143 560 16 0 1811 2370 569244427 569243868 0.000000e+00 946
20 TraesCS1B01G319800 chr6B 97.674 215 5 0 2157 2371 27637214 27637000 1.040000e-98 370
21 TraesCS1B01G319800 chr7D 91.262 206 17 1 1811 2016 35650875 35651079 1.800000e-71 279
22 TraesCS1B01G319800 chr7D 93.407 182 8 2 1 179 35634682 35634862 1.400000e-67 267
23 TraesCS1B01G319800 chr7D 93.182 176 11 1 2017 2191 35651037 35651212 8.410000e-65 257
24 TraesCS1B01G319800 chr6D 83.333 216 25 6 97 303 276910105 276909892 3.110000e-44 189


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G319800 chr1B 543842642 543845013 2371 False 4381.0 4381 100.000000 1 2372 1 chr1B.!!$F1 2371
1 TraesCS1B01G319800 chr4B 519325248 519327616 2368 False 4305.0 4305 99.452000 1 2372 1 chr4B.!!$F1 2371
2 TraesCS1B01G319800 chr3A 302927189 302929557 2368 False 4266.0 4266 99.157000 1 2372 1 chr3A.!!$F1 2371
3 TraesCS1B01G319800 chr4A 650158252 650160622 2370 True 4174.0 4174 98.441000 1 2372 1 chr4A.!!$R1 2371
4 TraesCS1B01G319800 chr4A 584730642 584731764 1122 False 1450.0 1450 90.009000 635 1771 1 chr4A.!!$F1 1136
5 TraesCS1B01G319800 chr4A 584682962 584684280 1318 True 843.5 1406 90.347500 635 2016 2 chr4A.!!$R2 1381
6 TraesCS1B01G319800 chr2B 58919302 58921687 2385 False 3441.0 3441 92.851000 1 2372 1 chr2B.!!$F1 2371
7 TraesCS1B01G319800 chr2B 52107917 52109910 1993 True 844.5 1205 91.253000 1 2372 2 chr2B.!!$R1 2371
8 TraesCS1B01G319800 chr3B 803140704 803142530 1826 True 2791.0 2791 94.255000 541 2372 1 chr3B.!!$R1 1831
9 TraesCS1B01G319800 chr3B 803186044 803186546 502 True 743.0 743 93.439000 44 543 1 chr3B.!!$R2 499
10 TraesCS1B01G319800 chr2A 120507002 120508806 1804 False 2713.0 2713 93.939000 1 1794 1 chr2A.!!$F1 1793
11 TraesCS1B01G319800 chr1A 516718019 516720272 2253 True 1386.5 2410 91.261500 1 2372 2 chr1A.!!$R1 2371
12 TraesCS1B01G319800 chr7B 489410052 489412349 2297 False 1039.0 2283 92.253667 1 2372 3 chr7B.!!$F1 2371
13 TraesCS1B01G319800 chr3D 569243868 569244427 559 True 946.0 946 97.143000 1811 2370 1 chr3D.!!$R1 559

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
281 290 0.695347 AAGGAGGTTTGGCTCTCAGG 59.305 55.0 0.0 0.0 0.0 3.86 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1950 2026 2.484287 CTTTGACCCCCAGCGACCAT 62.484 60.0 0.0 0.0 0.0 3.55 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
281 290 0.695347 AAGGAGGTTTGGCTCTCAGG 59.305 55.00 0.0 0.0 0.00 3.86
1387 1428 0.036388 TTGAGGGTTGGAGTCATCGC 60.036 55.00 0.0 0.0 0.00 4.58
2291 2375 9.743057 TGTAGACCAAAACATGTCAAAATTTAG 57.257 29.63 0.0 0.0 33.89 1.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
281 290 5.290885 TGTTATCATCGAGTGTTACACATGC 59.709 40.000 18.19 5.7 36.74 4.06
1950 2026 2.484287 CTTTGACCCCCAGCGACCAT 62.484 60.000 0.00 0.0 0.00 3.55
2291 2375 1.737008 GCAGAAGACCCGTCCGAAC 60.737 63.158 0.00 0.0 0.00 3.95


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.