Multiple sequence alignment - TraesCS1B01G315800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G315800 chr1B 100.000 2264 0 0 1 2264 540300147 540297884 0.000000e+00 4181.0
1 TraesCS1B01G315800 chr1B 98.429 2101 31 2 1 2100 540290569 540288470 0.000000e+00 3696.0
2 TraesCS1B01G315800 chr1B 94.940 2095 106 0 1 2095 549918915 549916821 0.000000e+00 3282.0
3 TraesCS1B01G315800 chr1B 94.115 1937 99 4 1 1937 504247933 504246012 0.000000e+00 2931.0
4 TraesCS1B01G315800 chr1B 90.473 1480 115 10 583 2056 612424167 612425626 0.000000e+00 1929.0
5 TraesCS1B01G315800 chr1B 96.571 175 5 1 2091 2264 540288029 540287855 2.850000e-74 289.0
6 TraesCS1B01G315800 chr1B 88.182 220 22 4 1996 2213 540297935 540298152 2.230000e-65 259.0
7 TraesCS1B01G315800 chr1B 92.308 104 7 1 1996 2098 540287906 540288009 1.810000e-31 147.0
8 TraesCS1B01G315800 chr1B 86.957 69 6 3 1911 1978 549916822 549916888 8.670000e-10 75.0
9 TraesCS1B01G315800 chr1B 84.211 76 8 4 1903 1977 504245561 504245633 1.120000e-08 71.3
10 TraesCS1B01G315800 chr2B 91.873 2104 144 12 1 2096 215847181 215849265 0.000000e+00 2913.0
11 TraesCS1B01G315800 chr2B 91.975 2056 133 10 1 2041 430232450 430230412 0.000000e+00 2854.0
12 TraesCS1B01G315800 chr2B 94.983 1774 88 1 1 1774 722906751 722904979 0.000000e+00 2782.0
13 TraesCS1B01G315800 chr2B 95.967 967 37 2 1 967 465664710 465663746 0.000000e+00 1568.0
14 TraesCS1B01G315800 chrUn 90.743 2074 145 22 1 2057 10399185 10401228 0.000000e+00 2723.0
15 TraesCS1B01G315800 chr1D 90.504 2064 155 23 1 2057 446419320 446421349 0.000000e+00 2687.0
16 TraesCS1B01G315800 chr5D 93.263 1796 109 3 1 1795 348341255 348343039 0.000000e+00 2636.0
17 TraesCS1B01G315800 chr3D 90.758 1991 146 20 1 1981 446922436 446924398 0.000000e+00 2623.0
18 TraesCS1B01G315800 chr3D 83.333 66 11 0 1913 1978 310408059 310407994 6.750000e-06 62.1
19 TraesCS1B01G315800 chr6B 94.011 1603 89 4 494 2095 605817300 605818896 0.000000e+00 2422.0
20 TraesCS1B01G315800 chr5B 96.360 1154 41 1 575 1728 98046319 98047471 0.000000e+00 1897.0
21 TraesCS1B01G315800 chr3B 86.154 65 9 0 1913 1977 809557512 809557448 1.120000e-08 71.3
22 TraesCS1B01G315800 chr4B 84.848 66 7 3 1913 1978 9635388 9635326 1.880000e-06 63.9


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G315800 chr1B 540297884 540300147 2263 True 4181.0 4181 100.000 1 2264 1 chr1B.!!$R2 2263
1 TraesCS1B01G315800 chr1B 549916821 549918915 2094 True 3282.0 3282 94.940 1 2095 1 chr1B.!!$R3 2094
2 TraesCS1B01G315800 chr1B 504246012 504247933 1921 True 2931.0 2931 94.115 1 1937 1 chr1B.!!$R1 1936
3 TraesCS1B01G315800 chr1B 540287855 540290569 2714 True 1992.5 3696 97.500 1 2264 2 chr1B.!!$R4 2263
4 TraesCS1B01G315800 chr1B 612424167 612425626 1459 False 1929.0 1929 90.473 583 2056 1 chr1B.!!$F5 1473
5 TraesCS1B01G315800 chr2B 215847181 215849265 2084 False 2913.0 2913 91.873 1 2096 1 chr2B.!!$F1 2095
6 TraesCS1B01G315800 chr2B 430230412 430232450 2038 True 2854.0 2854 91.975 1 2041 1 chr2B.!!$R1 2040
7 TraesCS1B01G315800 chr2B 722904979 722906751 1772 True 2782.0 2782 94.983 1 1774 1 chr2B.!!$R3 1773
8 TraesCS1B01G315800 chr2B 465663746 465664710 964 True 1568.0 1568 95.967 1 967 1 chr2B.!!$R2 966
9 TraesCS1B01G315800 chrUn 10399185 10401228 2043 False 2723.0 2723 90.743 1 2057 1 chrUn.!!$F1 2056
10 TraesCS1B01G315800 chr1D 446419320 446421349 2029 False 2687.0 2687 90.504 1 2057 1 chr1D.!!$F1 2056
11 TraesCS1B01G315800 chr5D 348341255 348343039 1784 False 2636.0 2636 93.263 1 1795 1 chr5D.!!$F1 1794
12 TraesCS1B01G315800 chr3D 446922436 446924398 1962 False 2623.0 2623 90.758 1 1981 1 chr3D.!!$F1 1980
13 TraesCS1B01G315800 chr6B 605817300 605818896 1596 False 2422.0 2422 94.011 494 2095 1 chr6B.!!$F1 1601
14 TraesCS1B01G315800 chr5B 98046319 98047471 1152 False 1897.0 1897 96.360 575 1728 1 chr5B.!!$F1 1153

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
657 664 0.250166 ACGGGCACTAGTCAAACACC 60.25 55.0 0.0 0.0 0.0 4.16 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2127 2627 2.264794 CCCTACAGTCGGCGCTTT 59.735 61.111 7.64 0.0 0.0 3.51 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
182 183 1.599797 GGGACAACAAGGGACGGTG 60.600 63.158 0.00 0.0 0.00 4.94
312 313 1.084289 GCGAGAAACTTGCCCGTATT 58.916 50.000 0.00 0.0 35.00 1.89
453 454 2.512515 GCCAGATCCCGCACTCAC 60.513 66.667 0.00 0.0 0.00 3.51
553 556 6.348950 CGAAGCAATTTGGTAGTGGTCATTTA 60.349 38.462 0.82 0.0 30.22 1.40
560 563 6.381498 TTGGTAGTGGTCATTTAATGGAGA 57.619 37.500 5.02 0.0 0.00 3.71
657 664 0.250166 ACGGGCACTAGTCAAACACC 60.250 55.000 0.00 0.0 0.00 4.16
666 673 3.846588 ACTAGTCAAACACCTGGATGGAT 59.153 43.478 0.00 0.0 39.71 3.41
1194 1213 6.192970 TGGATGGAAGGAAGGAGATATTTC 57.807 41.667 0.00 0.0 0.00 2.17
1767 1794 7.814264 TTTGCCATTTGTATTGAATTTGGTT 57.186 28.000 0.00 0.0 0.00 3.67
1908 1946 5.068987 TGTTTTGCTCTATTTCACTTTGGCT 59.931 36.000 0.00 0.0 0.00 4.75
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
7 8 2.413371 GGTCGTGCTTTCAGAATGCTTC 60.413 50.000 18.99 12.23 34.76 3.86
182 183 1.173913 GCAACTCCACCATAACACCC 58.826 55.000 0.00 0.00 0.00 4.61
453 454 1.048724 TCTTCCCCTCATAGGCACCG 61.049 60.000 0.00 0.00 32.73 4.94
528 531 2.811431 TGACCACTACCAAATTGCTTCG 59.189 45.455 0.00 0.00 0.00 3.79
553 556 1.348064 TGTTCTCCGGTGTCTCCATT 58.652 50.000 0.00 0.00 35.57 3.16
560 563 2.357637 CACAATTGTTGTTCTCCGGTGT 59.642 45.455 8.77 0.00 43.23 4.16
657 664 2.224475 CCAAGGCTAGTCATCCATCCAG 60.224 54.545 0.00 0.00 0.00 3.86
666 673 2.683916 CCACCTCCAAGGCTAGTCA 58.316 57.895 0.00 0.00 39.63 3.41
1194 1213 1.967319 AAGCATAGTTGGGGCATACG 58.033 50.000 0.00 0.00 0.00 3.06
1767 1794 2.548057 GACACCTTGCAAACATCTCGAA 59.452 45.455 0.00 0.00 0.00 3.71
1908 1946 4.015406 CTGTGGCGGTAGGGTGCA 62.015 66.667 0.00 0.00 0.00 4.57
2127 2627 2.264794 CCCTACAGTCGGCGCTTT 59.735 61.111 7.64 0.00 0.00 3.51
2233 2733 5.278604 GCAAACTTTCTGTGACGGTAAAAT 58.721 37.500 0.00 0.00 0.00 1.82


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.