Multiple sequence alignment - TraesCS1B01G309700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G309700 chr1B 100.000 2321 0 0 1 2321 532400119 532397799 0.000000e+00 4287.0
1 TraesCS1B01G309700 chr4B 98.624 1599 10 4 1 1595 636795264 636796854 0.000000e+00 2820.0
2 TraesCS1B01G309700 chr4B 98.741 715 9 0 1590 2304 636797098 636797812 0.000000e+00 1271.0
3 TraesCS1B01G309700 chr4B 87.023 131 15 2 1612 1740 461194739 461194609 1.860000e-31 147.0
4 TraesCS1B01G309700 chr4B 97.222 36 1 0 1321 1356 545447453 545447418 6.920000e-06 62.1
5 TraesCS1B01G309700 chr2A 91.397 1604 93 16 1 1595 343423649 343422082 0.000000e+00 2156.0
6 TraesCS1B01G309700 chr2A 92.566 417 29 1 1590 2006 343421839 343421425 4.270000e-167 597.0
7 TraesCS1B01G309700 chr2A 93.633 267 15 1 2039 2305 343421253 343420989 4.650000e-107 398.0
8 TraesCS1B01G309700 chr2A 90.769 130 8 2 2166 2291 762000596 762000725 1.100000e-38 171.0
9 TraesCS1B01G309700 chr5B 91.334 1604 94 13 1 1595 473287938 473289505 0.000000e+00 2150.0
10 TraesCS1B01G309700 chr5B 90.595 723 57 8 1590 2304 473289748 473290467 0.000000e+00 948.0
11 TraesCS1B01G309700 chr5B 97.222 36 1 0 1321 1356 684766698 684766663 6.920000e-06 62.1
12 TraesCS1B01G309700 chr7A 98.839 1206 7 4 1 1203 323741412 323740211 0.000000e+00 2143.0
13 TraesCS1B01G309700 chr7A 98.291 1112 13 5 486 1595 499350546 499349439 0.000000e+00 1943.0
14 TraesCS1B01G309700 chr7A 99.026 719 7 0 1591 2309 499349194 499348476 0.000000e+00 1290.0
15 TraesCS1B01G309700 chr7A 98.589 496 6 1 1 495 483951308 483951803 0.000000e+00 876.0
16 TraesCS1B01G309700 chr7A 99.364 472 3 0 1590 2061 323739699 323739228 0.000000e+00 856.0
17 TraesCS1B01G309700 chr7A 99.632 272 1 0 1324 1595 323740214 323739943 4.450000e-137 497.0
18 TraesCS1B01G309700 chr7A 98.990 198 1 1 2109 2305 323739233 323739036 1.020000e-93 353.0
19 TraesCS1B01G309700 chr3B 90.500 1600 118 17 1 1595 480499277 480500847 0.000000e+00 2082.0
20 TraesCS1B01G309700 chr3B 91.468 293 23 2 1661 1953 480501086 480501376 3.590000e-108 401.0
21 TraesCS1B01G309700 chrUn 100.000 417 0 0 676 1092 477121848 477122264 0.000000e+00 771.0
22 TraesCS1B01G309700 chrUn 94.751 381 18 1 519 899 480259082 480259460 1.990000e-165 592.0
23 TraesCS1B01G309700 chr2B 91.608 143 9 1 2167 2306 795261732 795261874 6.540000e-46 195.0
24 TraesCS1B01G309700 chr7D 86.897 145 10 4 1166 1301 83729080 83729224 1.110000e-33 154.0
25 TraesCS1B01G309700 chr7D 86.207 145 11 4 1166 1301 83669045 83669189 5.170000e-32 148.0
26 TraesCS1B01G309700 chr7B 86.207 145 11 4 1166 1301 33498524 33498668 5.170000e-32 148.0
27 TraesCS1B01G309700 chr1D 92.593 54 3 1 2256 2309 424741681 424741733 2.470000e-10 76.8
28 TraesCS1B01G309700 chr2D 90.741 54 5 0 2251 2304 640259838 640259785 3.200000e-09 73.1
29 TraesCS1B01G309700 chr5A 100.000 36 0 0 1321 1356 601638261 601638296 1.490000e-07 67.6


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G309700 chr1B 532397799 532400119 2320 True 4287.000000 4287 100.00000 1 2321 1 chr1B.!!$R1 2320
1 TraesCS1B01G309700 chr4B 636795264 636797812 2548 False 2045.500000 2820 98.68250 1 2304 2 chr4B.!!$F1 2303
2 TraesCS1B01G309700 chr2A 343420989 343423649 2660 True 1050.333333 2156 92.53200 1 2305 3 chr2A.!!$R1 2304
3 TraesCS1B01G309700 chr5B 473287938 473290467 2529 False 1549.000000 2150 90.96450 1 2304 2 chr5B.!!$F1 2303
4 TraesCS1B01G309700 chr7A 499348476 499350546 2070 True 1616.500000 1943 98.65850 486 2309 2 chr7A.!!$R2 1823
5 TraesCS1B01G309700 chr7A 323739036 323741412 2376 True 962.250000 2143 99.20625 1 2305 4 chr7A.!!$R1 2304
6 TraesCS1B01G309700 chr3B 480499277 480501376 2099 False 1241.500000 2082 90.98400 1 1953 2 chr3B.!!$F1 1952

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
185 192 1.311859 GGATTTCATGAGCATCGCCA 58.688 50.0 0.0 0.0 38.61 5.69 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2179 2588 2.558554 TAGAGCCTTTCCAGCGCGTC 62.559 60.0 8.43 0.0 34.97 5.19 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
185 192 1.311859 GGATTTCATGAGCATCGCCA 58.688 50.000 0.00 0.00 38.61 5.69
346 354 5.104277 TGTTTTCCCGGATAATGGTAGATGT 60.104 40.000 0.73 0.00 0.00 3.06
1144 1155 0.453793 CGGTGTGTTCCAAGTTTGCA 59.546 50.000 0.00 0.00 0.00 4.08
1789 2051 2.749621 CTGCAGAAGTGGTATGTTTCCC 59.250 50.000 8.42 0.00 0.00 3.97
2179 2588 1.405821 CCTATCGCTAGCCCGGAATAG 59.594 57.143 9.66 5.71 0.00 1.73
2309 2718 2.290367 CCATTCGCATTTTCCGCATAGA 59.710 45.455 0.00 0.00 0.00 1.98
2310 2719 3.243035 CCATTCGCATTTTCCGCATAGAA 60.243 43.478 0.00 0.00 0.00 2.10
2311 2720 4.539870 CATTCGCATTTTCCGCATAGAAT 58.460 39.130 0.00 0.00 0.00 2.40
2312 2721 3.607422 TCGCATTTTCCGCATAGAATG 57.393 42.857 0.00 0.00 33.71 2.67
2313 2722 2.290367 TCGCATTTTCCGCATAGAATGG 59.710 45.455 0.00 0.00 31.78 3.16
2314 2723 2.397549 GCATTTTCCGCATAGAATGGC 58.602 47.619 0.00 0.00 31.78 4.40
2315 2724 2.223782 GCATTTTCCGCATAGAATGGCA 60.224 45.455 0.00 0.00 31.78 4.92
2316 2725 3.635331 CATTTTCCGCATAGAATGGCAG 58.365 45.455 0.00 0.00 0.00 4.85
2317 2726 2.708216 TTTCCGCATAGAATGGCAGA 57.292 45.000 0.00 0.00 0.00 4.26
2318 2727 2.936919 TTCCGCATAGAATGGCAGAT 57.063 45.000 0.00 0.00 0.00 2.90
2319 2728 2.174363 TCCGCATAGAATGGCAGATG 57.826 50.000 0.00 0.00 0.00 2.90
2320 2729 1.693606 TCCGCATAGAATGGCAGATGA 59.306 47.619 0.00 0.00 0.00 2.92
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1144 1155 3.702045 GTCCATCCACTAGTAGCTTCAGT 59.298 47.826 0.00 0.0 0.00 3.41
1956 2218 2.940994 AGAGCACCGCTAGAGAGATA 57.059 50.000 0.00 0.0 39.88 1.98
2179 2588 2.558554 TAGAGCCTTTCCAGCGCGTC 62.559 60.000 8.43 0.0 34.97 5.19


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.