Multiple sequence alignment - TraesCS1B01G294100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G294100 chr1B 100.000 2959 0 0 1 2959 512050916 512053874 0.000000e+00 5465.0
1 TraesCS1B01G294100 chr2A 99.088 2959 22 2 1 2959 165103583 165106536 0.000000e+00 5310.0
2 TraesCS1B01G294100 chr2A 76.686 1364 218 53 709 2036 164866965 164868264 0.000000e+00 665.0
3 TraesCS1B01G294100 chr2A 83.179 755 91 21 1211 1957 165006971 165007697 0.000000e+00 658.0
4 TraesCS1B01G294100 chr2A 84.375 672 78 13 707 1368 164981213 164981867 4.160000e-178 634.0
5 TraesCS1B01G294100 chr2A 80.606 660 78 24 756 1397 164997651 164998278 5.780000e-127 464.0
6 TraesCS1B01G294100 chr2A 83.085 402 48 13 1545 1933 164982031 164982425 6.070000e-92 348.0
7 TraesCS1B01G294100 chr2A 84.375 160 16 6 2524 2680 165008729 165008882 6.610000e-32 148.0
8 TraesCS1B01G294100 chr2A 85.271 129 14 5 396 523 379822323 379822199 8.610000e-26 128.0
9 TraesCS1B01G294100 chr2A 88.372 86 4 5 623 704 164866658 164866741 6.750000e-17 99.0
10 TraesCS1B01G294100 chr2A 89.041 73 8 0 38 110 600527441 600527513 1.130000e-14 91.6
11 TraesCS1B01G294100 chr2A 97.561 41 1 0 1993 2033 164998678 164998718 1.470000e-08 71.3
12 TraesCS1B01G294100 chr2D 90.082 1593 91 31 708 2259 136515730 136514164 0.000000e+00 2004.0
13 TraesCS1B01G294100 chr2D 81.346 1308 162 41 707 1973 136523576 136522310 0.000000e+00 989.0
14 TraesCS1B01G294100 chr2D 88.131 674 45 22 707 1371 136634642 136633995 0.000000e+00 769.0
15 TraesCS1B01G294100 chr2D 76.591 1367 203 52 709 2036 136651662 136650374 0.000000e+00 643.0
16 TraesCS1B01G294100 chr2D 83.461 653 78 20 756 1397 136526368 136525735 5.500000e-162 580.0
17 TraesCS1B01G294100 chr2D 83.863 409 53 10 1545 1946 136612184 136611782 7.740000e-101 377.0
18 TraesCS1B01G294100 chr2D 78.819 576 71 30 1545 2108 136607753 136607217 1.020000e-89 340.0
19 TraesCS1B01G294100 chr2D 86.425 221 16 5 2257 2477 136514126 136513920 2.290000e-56 230.0
20 TraesCS1B01G294100 chr2D 75.787 508 70 26 1545 2042 136525738 136525274 1.070000e-49 207.0
21 TraesCS1B01G294100 chr2D 87.692 130 16 0 2830 2959 442975276 442975147 5.110000e-33 152.0
22 TraesCS1B01G294100 chr2D 84.375 160 17 6 2524 2680 136516046 136515892 1.840000e-32 150.0
23 TraesCS1B01G294100 chr2D 88.235 68 6 2 626 693 136634845 136634780 2.440000e-11 80.5
24 TraesCS1B01G294100 chr2D 89.062 64 6 1 630 693 136651997 136651935 8.790000e-11 78.7
25 TraesCS1B01G294100 chr2B 89.136 1574 107 28 707 2259 194955072 194953542 0.000000e+00 1901.0
26 TraesCS1B01G294100 chr2B 91.324 438 27 4 2329 2760 194953416 194952984 3.290000e-164 588.0
27 TraesCS1B01G294100 chr2B 84.854 581 46 20 812 1371 195167856 195167297 5.580000e-152 547.0
28 TraesCS1B01G294100 chr2B 83.225 614 82 13 1485 2095 194997400 194996805 7.210000e-151 544.0
29 TraesCS1B01G294100 chr2B 82.326 645 75 12 763 1398 195060045 195059431 9.400000e-145 523.0
30 TraesCS1B01G294100 chr2B 79.439 642 91 23 1355 1973 195008341 195007718 1.640000e-112 416.0
31 TraesCS1B01G294100 chr2B 78.819 576 71 29 1545 2108 195059435 195058899 1.020000e-89 340.0
32 TraesCS1B01G294100 chr2B 84.674 261 32 5 1227 1486 194997696 194997443 1.360000e-63 254.0
33 TraesCS1B01G294100 chr2B 91.241 137 9 3 2123 2257 194996813 194996678 1.810000e-42 183.0
34 TraesCS1B01G294100 chr2B 84.906 159 17 6 2524 2680 194996340 194996187 1.420000e-33 154.0
35 TraesCS1B01G294100 chr2B 92.308 52 4 0 642 693 195369226 195369175 1.140000e-09 75.0
36 TraesCS1B01G294100 chr2B 93.478 46 3 0 229 274 738164758 738164713 5.290000e-08 69.4
37 TraesCS1B01G294100 chrUn 100.000 418 0 0 2193 2610 477031178 477030761 0.000000e+00 773.0
38 TraesCS1B01G294100 chrUn 100.000 387 0 0 530 916 480490539 480490153 0.000000e+00 715.0
39 TraesCS1B01G294100 chr3B 83.696 276 38 5 1494 1767 462061213 462060943 1.360000e-63 254.0
40 TraesCS1B01G294100 chr3B 86.154 195 25 2 1292 1486 462061457 462061265 2.990000e-50 209.0
41 TraesCS1B01G294100 chr7B 89.412 170 17 1 229 397 161239555 161239724 2.310000e-51 213.0
42 TraesCS1B01G294100 chr7B 80.347 173 31 3 412 583 658067475 658067305 8.610000e-26 128.0
43 TraesCS1B01G294100 chr7A 87.931 174 16 3 229 397 206014895 206015068 1.800000e-47 200.0
44 TraesCS1B01G294100 chr1A 85.789 190 26 1 396 585 36175482 36175294 1.800000e-47 200.0
45 TraesCS1B01G294100 chr1A 90.769 130 12 0 2830 2959 144510944 144510815 1.090000e-39 174.0
46 TraesCS1B01G294100 chr5D 85.561 187 25 2 398 583 520113776 520113961 8.370000e-46 195.0
47 TraesCS1B01G294100 chr5D 81.935 155 26 2 244 397 384884257 384884104 2.390000e-26 130.0
48 TraesCS1B01G294100 chr5B 85.561 187 25 2 398 583 655121173 655121358 8.370000e-46 195.0
49 TraesCS1B01G294100 chr5B 90.164 61 6 0 38 98 655120894 655120954 2.440000e-11 80.5
50 TraesCS1B01G294100 chr5B 96.970 33 1 0 179 211 434512987 434512955 4.120000e-04 56.5
51 TraesCS1B01G294100 chr1D 85.882 170 22 2 229 397 262304655 262304823 2.340000e-41 180.0
52 TraesCS1B01G294100 chr1D 92.079 101 8 0 54 154 463469573 463469673 3.070000e-30 143.0
53 TraesCS1B01G294100 chr5A 90.769 130 12 0 2830 2959 401507635 401507506 1.090000e-39 174.0
54 TraesCS1B01G294100 chr5A 90.000 130 13 0 2830 2959 634467702 634467831 5.070000e-38 169.0
55 TraesCS1B01G294100 chr5A 88.372 129 15 0 2831 2959 184015980 184016108 3.950000e-34 156.0
56 TraesCS1B01G294100 chr4D 88.462 130 15 0 2830 2959 488486621 488486750 1.100000e-34 158.0
57 TraesCS1B01G294100 chr4D 95.082 61 3 0 38 98 468902023 468901963 2.430000e-16 97.1
58 TraesCS1B01G294100 chr4D 90.909 55 5 0 164 218 468901984 468901930 1.140000e-09 75.0
59 TraesCS1B01G294100 chr7D 87.692 130 16 0 2830 2959 83851499 83851628 5.110000e-33 152.0
60 TraesCS1B01G294100 chr6A 87.692 130 16 0 2830 2959 415094402 415094273 5.110000e-33 152.0
61 TraesCS1B01G294100 chr3D 90.698 43 4 0 56 98 338731412 338731370 1.150000e-04 58.4


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G294100 chr1B 512050916 512053874 2958 False 5465.000000 5465 100.000000 1 2959 1 chr1B.!!$F1 2958
1 TraesCS1B01G294100 chr2A 165103583 165106536 2953 False 5310.000000 5310 99.088000 1 2959 1 chr2A.!!$F1 2958
2 TraesCS1B01G294100 chr2A 164981213 164982425 1212 False 491.000000 634 83.730000 707 1933 2 chr2A.!!$F4 1226
3 TraesCS1B01G294100 chr2A 165006971 165008882 1911 False 403.000000 658 83.777000 1211 2680 2 chr2A.!!$F6 1469
4 TraesCS1B01G294100 chr2A 164866658 164868264 1606 False 382.000000 665 82.529000 623 2036 2 chr2A.!!$F3 1413
5 TraesCS1B01G294100 chr2A 164997651 164998718 1067 False 267.650000 464 89.083500 756 2033 2 chr2A.!!$F5 1277
6 TraesCS1B01G294100 chr2D 136513920 136516046 2126 True 794.666667 2004 86.960667 708 2680 3 chr2D.!!$R4 1972
7 TraesCS1B01G294100 chr2D 136522310 136526368 4058 True 592.000000 989 80.198000 707 2042 3 chr2D.!!$R5 1335
8 TraesCS1B01G294100 chr2D 136633995 136634845 850 True 424.750000 769 88.183000 626 1371 2 chr2D.!!$R6 745
9 TraesCS1B01G294100 chr2D 136650374 136651997 1623 True 360.850000 643 82.826500 630 2036 2 chr2D.!!$R7 1406
10 TraesCS1B01G294100 chr2D 136607217 136607753 536 True 340.000000 340 78.819000 1545 2108 1 chr2D.!!$R1 563
11 TraesCS1B01G294100 chr2B 194952984 194955072 2088 True 1244.500000 1901 90.230000 707 2760 2 chr2B.!!$R5 2053
12 TraesCS1B01G294100 chr2B 195167297 195167856 559 True 547.000000 547 84.854000 812 1371 1 chr2B.!!$R2 559
13 TraesCS1B01G294100 chr2B 195058899 195060045 1146 True 431.500000 523 80.572500 763 2108 2 chr2B.!!$R7 1345
14 TraesCS1B01G294100 chr2B 195007718 195008341 623 True 416.000000 416 79.439000 1355 1973 1 chr2B.!!$R1 618
15 TraesCS1B01G294100 chr2B 194996187 194997696 1509 True 283.750000 544 86.011500 1227 2680 4 chr2B.!!$R6 1453
16 TraesCS1B01G294100 chr3B 462060943 462061457 514 True 231.500000 254 84.925000 1292 1767 2 chr3B.!!$R1 475

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
916 1231 1.135315 CACGGCAATTTCGCTCCAG 59.865 57.895 0.0 0.0 0.0 3.86 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2902 7001 0.242825 GATGAGGACGTGACGGACAA 59.757 55.0 10.66 0.0 0.0 3.18 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
338 339 4.790962 CCAGCCGCAGTGGAGCAT 62.791 66.667 3.39 0.00 42.00 3.79
339 340 3.506096 CAGCCGCAGTGGAGCATG 61.506 66.667 3.39 0.00 42.00 4.06
340 341 4.790962 AGCCGCAGTGGAGCATGG 62.791 66.667 3.39 0.00 42.00 3.66
528 529 1.597937 CGGCCGCAGCTTAAATCAATC 60.598 52.381 14.67 0.00 39.73 2.67
916 1231 1.135315 CACGGCAATTTCGCTCCAG 59.865 57.895 0.00 0.00 0.00 3.86
2860 6959 2.676076 GCAAAATTGCGTCTGGAATGT 58.324 42.857 1.90 0.00 45.11 2.71
2909 7008 1.814211 CGCGTTTTCTCGTTGTCCGT 61.814 55.000 0.00 0.00 37.94 4.69
2931 7030 2.769621 TCCTCATCTGGCGGCCAT 60.770 61.111 24.10 5.58 30.82 4.40
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
154 155 4.060038 CGGTAGGGCAACGACGGT 62.060 66.667 0.00 0.00 37.60 4.83
437 438 0.250338 ACCTCGCGCCTTCTTTTTCT 60.250 50.000 0.00 0.00 0.00 2.52
509 510 1.269257 GGATTGATTTAAGCTGCGGCC 60.269 52.381 15.55 0.00 39.73 6.13
528 529 9.672086 TGAGTTCGTGAAAAACATATTTTAAGG 57.328 29.630 0.00 0.00 37.01 2.69
916 1231 2.226437 TGAAACAGCGATGGAGCTTTTC 59.774 45.455 5.32 6.19 46.80 2.29
2902 7001 0.242825 GATGAGGACGTGACGGACAA 59.757 55.000 10.66 0.00 0.00 3.18
2909 7008 2.710902 CCGCCAGATGAGGACGTGA 61.711 63.158 0.00 0.00 0.00 4.35


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.