Multiple sequence alignment - TraesCS1B01G262800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G262800 chr1B 100.000 2255 0 0 1 2255 461440079 461437825 0 4165
1 TraesCS1B01G262800 chr3A 98.625 2255 31 0 1 2255 495104802 495107056 0 3993
2 TraesCS1B01G262800 chr4D 98.316 2257 36 1 1 2255 123449028 123451284 0 3956
3 TraesCS1B01G262800 chr7A 98.226 2255 40 0 1 2255 708280788 708283042 0 3943
4 TraesCS1B01G262800 chr3B 98.184 2258 38 1 1 2255 92296774 92299031 0 3940
5 TraesCS1B01G262800 chr3B 97.783 2255 49 1 1 2255 6010808 6013061 0 3886
6 TraesCS1B01G262800 chr2B 98.052 2259 40 1 1 2255 234541202 234543460 0 3925
7 TraesCS1B01G262800 chr4B 97.916 2255 47 0 1 2255 209106616 209104362 0 3904
8 TraesCS1B01G262800 chr6D 97.828 2256 46 3 1 2255 108485166 108482913 0 3892
9 TraesCS1B01G262800 chr4A 97.783 2255 50 0 1 2255 67519456 67517202 0 3888


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G262800 chr1B 461437825 461440079 2254 True 4165 4165 100.000 1 2255 1 chr1B.!!$R1 2254
1 TraesCS1B01G262800 chr3A 495104802 495107056 2254 False 3993 3993 98.625 1 2255 1 chr3A.!!$F1 2254
2 TraesCS1B01G262800 chr4D 123449028 123451284 2256 False 3956 3956 98.316 1 2255 1 chr4D.!!$F1 2254
3 TraesCS1B01G262800 chr7A 708280788 708283042 2254 False 3943 3943 98.226 1 2255 1 chr7A.!!$F1 2254
4 TraesCS1B01G262800 chr3B 92296774 92299031 2257 False 3940 3940 98.184 1 2255 1 chr3B.!!$F2 2254
5 TraesCS1B01G262800 chr3B 6010808 6013061 2253 False 3886 3886 97.783 1 2255 1 chr3B.!!$F1 2254
6 TraesCS1B01G262800 chr2B 234541202 234543460 2258 False 3925 3925 98.052 1 2255 1 chr2B.!!$F1 2254
7 TraesCS1B01G262800 chr4B 209104362 209106616 2254 True 3904 3904 97.916 1 2255 1 chr4B.!!$R1 2254
8 TraesCS1B01G262800 chr6D 108482913 108485166 2253 True 3892 3892 97.828 1 2255 1 chr6D.!!$R1 2254
9 TraesCS1B01G262800 chr4A 67517202 67519456 2254 True 3888 3888 97.783 1 2255 1 chr4A.!!$R1 2254

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
259 260 0.036732 ATCGTCTTGAAAGCTGGGCA 59.963 50.0 0.0 0.0 0.0 5.36 F
432 433 0.927029 GGGGGCTGGGTTCTATTTCT 59.073 55.0 0.0 0.0 0.0 2.52 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1136 1138 0.677414 TGAATGCAAGATGCCAGCGA 60.677 50.000 0.00 0.0 44.23 4.93 R
1570 1572 1.401018 GCCTACACGCGAATTTGCTTT 60.401 47.619 15.93 0.0 0.00 3.51 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
68 69 1.203052 GATAGGGTCAACGACGGAACA 59.797 52.381 0.00 0.0 32.65 3.18
259 260 0.036732 ATCGTCTTGAAAGCTGGGCA 59.963 50.000 0.00 0.0 0.00 5.36
432 433 0.927029 GGGGGCTGGGTTCTATTTCT 59.073 55.000 0.00 0.0 0.00 2.52
507 509 6.575649 CGGTAAGGAAGAGGATAAAAAGGTGA 60.576 42.308 0.00 0.0 0.00 4.02
536 538 1.446272 CTCGACCTGTTTCCCGAGC 60.446 63.158 0.00 0.0 41.31 5.03
1136 1138 2.419297 GCCTCTGTCTGGTCGATCATTT 60.419 50.000 0.00 0.0 0.00 2.32
1357 1359 0.103208 ATTCAGTGACTCCGCGATCC 59.897 55.000 8.23 0.0 0.00 3.36
1540 1542 4.957954 AGCCCAGCATTCATTCTAAAATCA 59.042 37.500 0.00 0.0 0.00 2.57
1679 1687 1.660167 CAGAATGAATGAGCCGCTCA 58.340 50.000 24.90 24.9 41.58 4.26
1746 1754 2.204090 TCCGGGCTCCCTTTCCTT 60.204 61.111 0.00 0.0 0.00 3.36
2035 2043 4.125695 GACCCGCCTACGCTCGTT 62.126 66.667 0.00 0.0 38.22 3.85
2222 2230 1.043816 GCATAGGAGCCTACTCAGCA 58.956 55.000 0.00 0.0 45.42 4.41
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
68 69 4.093850 AGCTGTCGTAAAGTTTCGTTGTTT 59.906 37.500 0.00 0.0 0.00 2.83
259 260 3.011708 AGCCCCACTCATATTCAAAAGGT 59.988 43.478 0.00 0.0 0.00 3.50
507 509 5.221342 GGAAACAGGTCGAGATAGATGACAT 60.221 44.000 0.00 0.0 34.32 3.06
536 538 0.802494 CCGGTCTTCATTTCCAACGG 59.198 55.000 0.00 0.0 0.00 4.44
894 896 0.966370 GACAGAGGGCTCGTGGTACT 60.966 60.000 0.00 0.0 34.09 2.73
1136 1138 0.677414 TGAATGCAAGATGCCAGCGA 60.677 50.000 0.00 0.0 44.23 4.93
1156 1158 2.281484 GGCAGTCAAACGGAGGCA 60.281 61.111 0.00 0.0 0.00 4.75
1357 1359 6.120220 ACCTTATTTTGATCGTTTAGAGGGG 58.880 40.000 6.82 0.0 0.00 4.79
1540 1542 4.867047 CGAGCAGTCTCAATTTCACTACAT 59.133 41.667 0.00 0.0 39.30 2.29
1570 1572 1.401018 GCCTACACGCGAATTTGCTTT 60.401 47.619 15.93 0.0 0.00 3.51
1679 1687 3.502123 TTTGACGGAAATGGAAGGTCT 57.498 42.857 0.00 0.0 0.00 3.85


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.