Multiple sequence alignment - TraesCS1B01G246300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G246300 chr1B 100.000 3122 0 0 1 3122 436146026 436149147 0.000000e+00 5766.0
1 TraesCS1B01G246300 chr1B 98.909 3116 10 1 4 3119 436074587 436077678 0.000000e+00 5544.0
2 TraesCS1B01G246300 chr1B 85.043 936 73 21 2253 3122 365029996 365029062 0.000000e+00 891.0
3 TraesCS1B01G246300 chrUn 99.709 1719 5 0 1401 3119 376896767 376895049 0.000000e+00 3147.0
4 TraesCS1B01G246300 chr1D 95.472 1303 50 3 851 2144 323871212 323872514 0.000000e+00 2071.0
5 TraesCS1B01G246300 chr1D 88.337 866 57 23 4 848 323866589 323867431 0.000000e+00 1000.0
6 TraesCS1B01G246300 chr1D 83.929 672 73 23 2255 2898 92381280 92381944 7.400000e-171 610.0
7 TraesCS1B01G246300 chr1D 98.198 111 2 0 2144 2254 323872557 323872667 8.830000e-46 195.0
8 TraesCS1B01G246300 chr1A 95.408 1263 50 3 885 2144 423675470 423676727 0.000000e+00 2004.0
9 TraesCS1B01G246300 chr1A 92.610 433 30 2 6 437 423665207 423665638 3.420000e-174 621.0
10 TraesCS1B01G246300 chr1A 88.043 92 1 4 2144 2225 423676770 423676861 1.980000e-17 100.0
11 TraesCS1B01G246300 chr7B 86.601 918 71 17 2253 3122 533785298 533784385 0.000000e+00 966.0
12 TraesCS1B01G246300 chr4B 85.652 913 87 16 2253 3122 343924190 343923279 0.000000e+00 920.0
13 TraesCS1B01G246300 chr4B 84.440 919 90 20 2253 3119 343918873 343917956 0.000000e+00 856.0
14 TraesCS1B01G246300 chr5D 83.408 898 103 24 2255 3119 119608035 119608919 0.000000e+00 791.0
15 TraesCS1B01G246300 chr5D 81.849 898 110 32 2255 3122 243311245 243310371 0.000000e+00 706.0
16 TraesCS1B01G246300 chr2D 83.295 880 100 27 2253 3101 610270959 610271822 0.000000e+00 767.0
17 TraesCS1B01G246300 chr2D 83.257 878 100 27 2255 3101 610265372 610266233 0.000000e+00 763.0
18 TraesCS1B01G246300 chr6B 82.805 884 118 30 2255 3119 298335743 298334875 0.000000e+00 760.0
19 TraesCS1B01G246300 chr6B 87.812 640 45 7 2512 3119 434180328 434180966 0.000000e+00 719.0
20 TraesCS1B01G246300 chr5A 81.579 912 112 29 2255 3122 457429445 457428546 0.000000e+00 702.0
21 TraesCS1B01G246300 chr2A 84.889 675 60 12 2253 2898 581561874 581562535 0.000000e+00 643.0
22 TraesCS1B01G246300 chr7D 87.727 440 47 5 2252 2690 29739300 29739733 9.990000e-140 507.0
23 TraesCS1B01G246300 chr6D 97.143 35 1 0 220 254 266052330 266052364 3.360000e-05 60.2
24 TraesCS1B01G246300 chr3B 100.000 31 0 0 216 246 427959475 427959445 1.210000e-04 58.4


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G246300 chr1B 436146026 436149147 3121 False 5766.000000 5766 100.000000 1 3122 1 chr1B.!!$F2 3121
1 TraesCS1B01G246300 chr1B 436074587 436077678 3091 False 5544.000000 5544 98.909000 4 3119 1 chr1B.!!$F1 3115
2 TraesCS1B01G246300 chr1B 365029062 365029996 934 True 891.000000 891 85.043000 2253 3122 1 chr1B.!!$R1 869
3 TraesCS1B01G246300 chrUn 376895049 376896767 1718 True 3147.000000 3147 99.709000 1401 3119 1 chrUn.!!$R1 1718
4 TraesCS1B01G246300 chr1D 323866589 323872667 6078 False 1088.666667 2071 94.002333 4 2254 3 chr1D.!!$F2 2250
5 TraesCS1B01G246300 chr1D 92381280 92381944 664 False 610.000000 610 83.929000 2255 2898 1 chr1D.!!$F1 643
6 TraesCS1B01G246300 chr1A 423675470 423676861 1391 False 1052.000000 2004 91.725500 885 2225 2 chr1A.!!$F2 1340
7 TraesCS1B01G246300 chr7B 533784385 533785298 913 True 966.000000 966 86.601000 2253 3122 1 chr7B.!!$R1 869
8 TraesCS1B01G246300 chr4B 343923279 343924190 911 True 920.000000 920 85.652000 2253 3122 1 chr4B.!!$R2 869
9 TraesCS1B01G246300 chr4B 343917956 343918873 917 True 856.000000 856 84.440000 2253 3119 1 chr4B.!!$R1 866
10 TraesCS1B01G246300 chr5D 119608035 119608919 884 False 791.000000 791 83.408000 2255 3119 1 chr5D.!!$F1 864
11 TraesCS1B01G246300 chr5D 243310371 243311245 874 True 706.000000 706 81.849000 2255 3122 1 chr5D.!!$R1 867
12 TraesCS1B01G246300 chr2D 610270959 610271822 863 False 767.000000 767 83.295000 2253 3101 1 chr2D.!!$F2 848
13 TraesCS1B01G246300 chr2D 610265372 610266233 861 False 763.000000 763 83.257000 2255 3101 1 chr2D.!!$F1 846
14 TraesCS1B01G246300 chr6B 298334875 298335743 868 True 760.000000 760 82.805000 2255 3119 1 chr6B.!!$R1 864
15 TraesCS1B01G246300 chr6B 434180328 434180966 638 False 719.000000 719 87.812000 2512 3119 1 chr6B.!!$F1 607
16 TraesCS1B01G246300 chr5A 457428546 457429445 899 True 702.000000 702 81.579000 2255 3122 1 chr5A.!!$R1 867
17 TraesCS1B01G246300 chr2A 581561874 581562535 661 False 643.000000 643 84.889000 2253 2898 1 chr2A.!!$F1 645

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
910 4709 0.957395 AGCAACCATCAAGTGCTCCG 60.957 55.0 0.0 0.0 0.0 4.63 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2331 6198 1.526575 CCTTGCCTTGCACGAATGGT 61.527 55.0 0.0 0.0 38.71 3.55 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
347 349 7.799014 ACAGACCTTGTAATGATGTGATCATGT 60.799 37.037 0.00 0.0 42.52 3.21
444 446 1.376649 AGGCTTCCTTGAACAGGGAT 58.623 50.000 6.50 0.0 44.12 3.85
647 668 2.464459 GCCGCGCTAGCAATGAAGT 61.464 57.895 16.45 0.0 45.49 3.01
848 869 3.004002 TGATGTGTGAGAAAAGCAGCAAG 59.996 43.478 0.00 0.0 0.00 4.01
910 4709 0.957395 AGCAACCATCAAGTGCTCCG 60.957 55.000 0.00 0.0 0.00 4.63
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
347 349 5.722021 TGCAGATGTCTGACAACTACTTA 57.278 39.130 18.47 4.90 46.59 2.24
357 359 4.644498 TCACAAGAAATGCAGATGTCTGA 58.356 39.130 13.94 0.15 46.59 3.27
404 406 5.767168 GCCTATGAGCAATATCAGGAGTTTT 59.233 40.000 0.00 0.00 31.44 2.43
444 446 9.601217 GAGGATCTAACTGCACTTTTTAATCTA 57.399 33.333 0.00 0.00 0.00 1.98
647 668 0.102481 GGCGCGGATGAAGAGAAGTA 59.898 55.000 8.83 0.00 0.00 2.24
910 4709 1.167781 TCGGTTTCTTTTCCGGTGGC 61.168 55.000 0.00 0.00 45.79 5.01
2331 6198 1.526575 CCTTGCCTTGCACGAATGGT 61.527 55.000 0.00 0.00 38.71 3.55
2410 6277 2.514160 ACAAGTGGGGAAAGAACCTTCT 59.486 45.455 0.00 0.00 39.74 2.85


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.