Multiple sequence alignment - TraesCS1B01G231700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G231700 chr1B 100.000 2375 0 0 1 2375 416150283 416147909 0.000000e+00 4386
1 TraesCS1B01G231700 chr1B 97.598 999 24 0 1 999 416157263 416156265 0.000000e+00 1712
2 TraesCS1B01G231700 chr1B 89.150 1235 111 17 1155 2375 556071581 556070356 0.000000e+00 1517
3 TraesCS1B01G231700 chr1B 93.896 983 54 4 22 999 366475010 366475991 0.000000e+00 1478
4 TraesCS1B01G231700 chr2B 97.815 1373 30 0 1000 2372 295833526 295834898 0.000000e+00 2370
5 TraesCS1B01G231700 chr2B 92.114 1230 80 13 1155 2375 330764666 330765887 0.000000e+00 1718
6 TraesCS1B01G231700 chr2B 90.717 1228 89 18 1160 2375 724013002 724011788 0.000000e+00 1613
7 TraesCS1B01G231700 chr2B 87.599 1387 133 24 999 2375 575352236 575353593 0.000000e+00 1572
8 TraesCS1B01G231700 chr2B 89.321 1208 106 16 1184 2375 570518829 570517629 0.000000e+00 1495
9 TraesCS1B01G231700 chr2B 83.721 172 22 5 1000 1168 298277032 298277200 8.790000e-35 158
10 TraesCS1B01G231700 chr2B 81.622 185 28 5 999 1180 397512270 397512089 5.290000e-32 148
11 TraesCS1B01G231700 chr4B 87.634 1399 135 19 1000 2375 154112263 154110880 0.000000e+00 1591
12 TraesCS1B01G231700 chr4B 93.028 1004 60 7 1 996 510003560 510004561 0.000000e+00 1458
13 TraesCS1B01G231700 chr4D 87.374 1386 132 22 1000 2375 163412523 163411171 0.000000e+00 1550
14 TraesCS1B01G231700 chr3B 94.200 1000 53 4 3 1000 576386557 576387553 0.000000e+00 1520
15 TraesCS1B01G231700 chr5B 93.994 999 52 5 1 999 456404310 456405300 0.000000e+00 1506
16 TraesCS1B01G231700 chr5B 93.110 987 59 7 21 999 703662513 703663498 0.000000e+00 1437
17 TraesCS1B01G231700 chr5B 92.475 1010 64 9 1 999 523809975 523810983 0.000000e+00 1434
18 TraesCS1B01G231700 chr6B 88.129 1272 117 18 1123 2375 459693158 459694414 0.000000e+00 1482
19 TraesCS1B01G231700 chr6B 92.744 1006 66 6 1 1001 45924136 45925139 0.000000e+00 1447
20 TraesCS1B01G231700 chr6B 83.152 184 25 5 1000 1180 115925493 115925313 1.890000e-36 163
21 TraesCS1B01G231700 chr6B 84.302 172 21 5 1000 1168 459692999 459693167 1.890000e-36 163
22 TraesCS1B01G231700 chr7B 93.374 981 60 5 21 999 468800523 468801500 0.000000e+00 1447
23 TraesCS1B01G231700 chr7B 82.609 184 26 5 1000 1180 476086812 476086632 8.790000e-35 158
24 TraesCS1B01G231700 chrUn 83.152 184 25 6 1000 1180 79018986 79018806 1.890000e-36 163


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G231700 chr1B 416147909 416150283 2374 True 4386.0 4386 100.0000 1 2375 1 chr1B.!!$R1 2374
1 TraesCS1B01G231700 chr1B 416156265 416157263 998 True 1712.0 1712 97.5980 1 999 1 chr1B.!!$R2 998
2 TraesCS1B01G231700 chr1B 556070356 556071581 1225 True 1517.0 1517 89.1500 1155 2375 1 chr1B.!!$R3 1220
3 TraesCS1B01G231700 chr1B 366475010 366475991 981 False 1478.0 1478 93.8960 22 999 1 chr1B.!!$F1 977
4 TraesCS1B01G231700 chr2B 295833526 295834898 1372 False 2370.0 2370 97.8150 1000 2372 1 chr2B.!!$F1 1372
5 TraesCS1B01G231700 chr2B 330764666 330765887 1221 False 1718.0 1718 92.1140 1155 2375 1 chr2B.!!$F3 1220
6 TraesCS1B01G231700 chr2B 724011788 724013002 1214 True 1613.0 1613 90.7170 1160 2375 1 chr2B.!!$R3 1215
7 TraesCS1B01G231700 chr2B 575352236 575353593 1357 False 1572.0 1572 87.5990 999 2375 1 chr2B.!!$F4 1376
8 TraesCS1B01G231700 chr2B 570517629 570518829 1200 True 1495.0 1495 89.3210 1184 2375 1 chr2B.!!$R2 1191
9 TraesCS1B01G231700 chr4B 154110880 154112263 1383 True 1591.0 1591 87.6340 1000 2375 1 chr4B.!!$R1 1375
10 TraesCS1B01G231700 chr4B 510003560 510004561 1001 False 1458.0 1458 93.0280 1 996 1 chr4B.!!$F1 995
11 TraesCS1B01G231700 chr4D 163411171 163412523 1352 True 1550.0 1550 87.3740 1000 2375 1 chr4D.!!$R1 1375
12 TraesCS1B01G231700 chr3B 576386557 576387553 996 False 1520.0 1520 94.2000 3 1000 1 chr3B.!!$F1 997
13 TraesCS1B01G231700 chr5B 456404310 456405300 990 False 1506.0 1506 93.9940 1 999 1 chr5B.!!$F1 998
14 TraesCS1B01G231700 chr5B 703662513 703663498 985 False 1437.0 1437 93.1100 21 999 1 chr5B.!!$F3 978
15 TraesCS1B01G231700 chr5B 523809975 523810983 1008 False 1434.0 1434 92.4750 1 999 1 chr5B.!!$F2 998
16 TraesCS1B01G231700 chr6B 45924136 45925139 1003 False 1447.0 1447 92.7440 1 1001 1 chr6B.!!$F1 1000
17 TraesCS1B01G231700 chr6B 459692999 459694414 1415 False 822.5 1482 86.2155 1000 2375 2 chr6B.!!$F2 1375
18 TraesCS1B01G231700 chr7B 468800523 468801500 977 False 1447.0 1447 93.3740 21 999 1 chr7B.!!$F1 978

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
505 533 1.549037 GCCCAGAGATACCTCTCCGAT 60.549 57.143 0.0 0.0 46.38 4.18 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2095 2186 1.202651 GGAACATACCACCGATCCAGG 60.203 57.143 0.0 0.0 37.3 4.45 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
350 352 2.139917 CGTTGTTCCCTTTGTCATCGA 58.860 47.619 0.00 0.0 0.00 3.59
363 365 6.258727 CCTTTGTCATCGATATGTTACTTGCT 59.741 38.462 0.00 0.0 34.50 3.91
456 483 6.187125 ACTCATTAGTTACAATGCTTGCAG 57.813 37.500 0.87 0.0 36.13 4.41
505 533 1.549037 GCCCAGAGATACCTCTCCGAT 60.549 57.143 0.00 0.0 46.38 4.18
597 625 6.911308 AGCACCTTTATAATCACCCAGTTAT 58.089 36.000 0.00 0.0 0.00 1.89
634 662 1.668751 GCACACAAAGTGTTCTTCCGA 59.331 47.619 0.00 0.0 45.08 4.55
812 844 4.572389 GCAACACATGTCTATGGTTAGGAG 59.428 45.833 0.00 0.0 38.66 3.69
1085 1118 5.439721 TGTTAGTGGCATTGCTCATATCTT 58.560 37.500 8.82 0.0 0.00 2.40
1431 1503 1.419012 CTGGAGCAGGCATGAGGATAA 59.581 52.381 0.62 0.0 0.00 1.75
1496 1571 3.678806 CGAGTGCTACTTCATTAAGCCCA 60.679 47.826 0.00 0.0 36.05 5.36
1798 1882 6.554982 ACCTAGATCACCATGTTTAGATGCTA 59.445 38.462 0.00 0.0 0.00 3.49
2055 2143 6.286240 TGGATCGGATAGGAGTTAATGATG 57.714 41.667 0.00 0.0 0.00 3.07
2247 2347 6.158598 TGCTTCCTTCAAATTCAATAAGTGC 58.841 36.000 0.00 0.0 0.00 4.40
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
76 78 3.665190 GACGAGGAGTCTCAAAATGGTT 58.335 45.455 1.47 0.00 46.13 3.67
350 352 8.554528 CGATCAAATCTCAAGCAAGTAACATAT 58.445 33.333 0.00 0.00 0.00 1.78
363 365 4.098807 TGGATACCGACGATCAAATCTCAA 59.901 41.667 0.00 0.00 0.00 3.02
456 483 4.560919 CGGTAATACTCATCACCTAAGCCC 60.561 50.000 0.00 0.00 0.00 5.19
505 533 6.942976 AGATTAGGTTTTGTCACTCCGATTA 58.057 36.000 0.00 0.00 0.00 1.75
597 625 1.666700 GTGCTACCAAACGTCACAACA 59.333 47.619 0.00 0.00 0.00 3.33
634 662 5.263599 TGAGATTGTGCAACTCCCATTTAT 58.736 37.500 0.00 0.00 38.04 1.40
789 819 4.513442 TCCTAACCATAGACATGTGTTGC 58.487 43.478 1.15 0.00 31.85 4.17
898 931 8.567948 CATGCTAGAATTGTATTAACCGGAAAT 58.432 33.333 9.46 10.35 0.00 2.17
1213 1282 6.462500 CCTCCAAGTCATCAATCGAATATCT 58.538 40.000 0.00 0.00 0.00 1.98
1431 1503 2.374839 AGCTCCTCTCCTTTTGCTTCTT 59.625 45.455 0.00 0.00 0.00 2.52
1496 1571 1.421268 TGGGTCATGAAACAGCTCACT 59.579 47.619 0.00 0.00 0.00 3.41
1592 1674 5.481105 CACAATGCCAAAGGTGAAATACAT 58.519 37.500 0.00 0.00 33.16 2.29
1595 1677 3.577848 AGCACAATGCCAAAGGTGAAATA 59.422 39.130 0.00 0.00 46.52 1.40
1717 1801 8.312564 GTTTTCTAGTGTACTAGGGATTTGAGT 58.687 37.037 16.66 0.00 44.60 3.41
1798 1882 6.141847 TGGGAACACACTTGGCACAAATTT 62.142 41.667 0.00 0.00 38.98 1.82
2095 2186 1.202651 GGAACATACCACCGATCCAGG 60.203 57.143 0.00 0.00 37.30 4.45


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.