Multiple sequence alignment - TraesCS1B01G213000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G213000 chr1B 100.000 2795 0 0 1 2795 386615411 386618205 0.000000e+00 5162
1 TraesCS1B01G213000 chr1B 97.061 1327 38 1 101 1427 86699049 86700374 0.000000e+00 2233
2 TraesCS1B01G213000 chr1B 95.418 1113 30 1 1328 2440 86700372 86701463 0.000000e+00 1753
3 TraesCS1B01G213000 chr1B 96.676 361 12 0 2435 2795 86701535 86701895 3.980000e-168 601
4 TraesCS1B01G213000 chr2D 96.648 2357 76 2 1 2357 257220879 257218526 0.000000e+00 3912
5 TraesCS1B01G213000 chr2D 94.675 338 15 3 2458 2795 257218063 257217729 3.190000e-144 521
6 TraesCS1B01G213000 chr3D 92.100 2443 186 6 1 2440 204092586 204090148 0.000000e+00 3435
7 TraesCS1B01G213000 chr3D 91.414 1945 142 10 1 1944 220645490 220643570 0.000000e+00 2643
8 TraesCS1B01G213000 chr3D 91.000 500 42 2 1941 2440 220639116 220638620 0.000000e+00 671
9 TraesCS1B01G213000 chr3D 88.474 321 28 8 2479 2795 204090018 204089703 2.030000e-101 379
10 TraesCS1B01G213000 chr4A 90.657 2376 202 16 1 2370 245395499 245397860 0.000000e+00 3140
11 TraesCS1B01G213000 chr5A 90.400 2375 195 19 1 2370 489002723 489005069 0.000000e+00 3092
12 TraesCS1B01G213000 chr3B 91.121 1588 131 6 879 2458 496839378 496837793 0.000000e+00 2143
13 TraesCS1B01G213000 chr6A 90.555 1567 142 5 878 2440 180862737 180861173 0.000000e+00 2069
14 TraesCS1B01G213000 chr6A 93.533 835 51 3 1 834 180863577 180862745 0.000000e+00 1240
15 TraesCS1B01G213000 chr2B 90.543 1565 144 3 878 2439 77368470 77370033 0.000000e+00 2067
16 TraesCS1B01G213000 chr2B 93.062 836 54 4 1 834 77367629 77368462 0.000000e+00 1219
17 TraesCS1B01G213000 chr4B 89.732 1568 154 7 878 2440 224350785 224352350 0.000000e+00 1997
18 TraesCS1B01G213000 chr5B 94.646 1158 61 1 1 1157 224518981 224520138 0.000000e+00 1794


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G213000 chr1B 386615411 386618205 2794 False 5162.0 5162 100.0000 1 2795 1 chr1B.!!$F1 2794
1 TraesCS1B01G213000 chr1B 86699049 86701895 2846 False 1529.0 2233 96.3850 101 2795 3 chr1B.!!$F2 2694
2 TraesCS1B01G213000 chr2D 257217729 257220879 3150 True 2216.5 3912 95.6615 1 2795 2 chr2D.!!$R1 2794
3 TraesCS1B01G213000 chr3D 220643570 220645490 1920 True 2643.0 2643 91.4140 1 1944 1 chr3D.!!$R2 1943
4 TraesCS1B01G213000 chr3D 204089703 204092586 2883 True 1907.0 3435 90.2870 1 2795 2 chr3D.!!$R3 2794
5 TraesCS1B01G213000 chr4A 245395499 245397860 2361 False 3140.0 3140 90.6570 1 2370 1 chr4A.!!$F1 2369
6 TraesCS1B01G213000 chr5A 489002723 489005069 2346 False 3092.0 3092 90.4000 1 2370 1 chr5A.!!$F1 2369
7 TraesCS1B01G213000 chr3B 496837793 496839378 1585 True 2143.0 2143 91.1210 879 2458 1 chr3B.!!$R1 1579
8 TraesCS1B01G213000 chr6A 180861173 180863577 2404 True 1654.5 2069 92.0440 1 2440 2 chr6A.!!$R1 2439
9 TraesCS1B01G213000 chr2B 77367629 77370033 2404 False 1643.0 2067 91.8025 1 2439 2 chr2B.!!$F1 2438
10 TraesCS1B01G213000 chr4B 224350785 224352350 1565 False 1997.0 1997 89.7320 878 2440 1 chr4B.!!$F1 1562
11 TraesCS1B01G213000 chr5B 224518981 224520138 1157 False 1794.0 1794 94.6460 1 1157 1 chr5B.!!$F1 1156

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
351 357 0.905809 ATGCCCTGCCATGAAAGCAA 60.906 50.0 0.0 0.0 40.35 3.91 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2271 2401 2.234661 CTGGTGAACCATCTGCTCTGTA 59.765 50.0 1.88 0.0 46.46 2.74 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
351 357 0.905809 ATGCCCTGCCATGAAAGCAA 60.906 50.000 0.00 0.00 40.35 3.91
623 634 6.753913 TCTGCATACTGGAAGGAGATATTT 57.246 37.500 0.00 0.00 39.30 1.40
637 648 4.217118 GGAGATATTTTGCGCCAGAATGAT 59.783 41.667 4.18 0.00 39.69 2.45
727 738 4.156556 GCTTCACATATTTGCCAGACAAGA 59.843 41.667 0.00 0.00 40.06 3.02
741 752 5.221185 GCCAGACAAGACAATGAATGCATAT 60.221 40.000 0.00 0.00 33.44 1.78
839 851 2.284263 GCAGTTAGCTTTCAATGGCC 57.716 50.000 0.00 0.00 41.15 5.36
1131 1147 5.891551 ACACCACTACAACCAAGAGAAAAAT 59.108 36.000 0.00 0.00 0.00 1.82
1215 1233 3.303990 GCGAGTGCAAACTCTTTGATCAA 60.304 43.478 3.38 3.38 43.26 2.57
1254 1273 8.719560 AAGAGCTACTCATCATGCATATATTG 57.280 34.615 0.00 0.00 32.06 1.90
1617 1738 2.501316 TCTGAACGGTGATGACATGGAT 59.499 45.455 0.00 0.00 0.00 3.41
1792 1915 0.527565 GAGTGCGGCCATGAAACAAT 59.472 50.000 2.24 0.00 0.00 2.71
2178 2306 1.551883 GATGTTGGGCAAGGCAAGATT 59.448 47.619 0.00 0.00 0.00 2.40
2271 2401 7.783596 AGAATAGGCAATGAGATTCTGGAAATT 59.216 33.333 0.00 0.00 37.28 1.82
2479 2970 2.824689 TGATTTATGCAGCTTCCCCA 57.175 45.000 0.00 0.00 0.00 4.96
2567 3058 6.463614 GGTTAGCATGTACAGATCCTCAAGAT 60.464 42.308 0.33 0.00 38.17 2.40
2675 3167 7.663081 GCTTCAGTTAGATCCCATGAATAATGA 59.337 37.037 0.00 0.00 38.72 2.57
2721 3213 1.656587 TAACTGGCAGTCCACCTGAT 58.343 50.000 22.31 4.93 44.49 2.90
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
229 230 4.344865 GGGGCTTGGAGGCGTTCA 62.345 66.667 0.00 0.00 42.43 3.18
623 634 1.199789 GTTGACATCATTCTGGCGCAA 59.800 47.619 10.83 0.00 0.00 4.85
637 648 3.730662 GCTTTCGCTTCTTTGTGTTGACA 60.731 43.478 0.00 0.00 0.00 3.58
686 697 4.217334 TGAAGCACTTGTGTTTCTTTCACA 59.783 37.500 23.47 7.24 42.84 3.58
727 738 6.206243 GTGCCTCTTCTATATGCATTCATTGT 59.794 38.462 3.54 0.00 34.04 2.71
741 752 1.552337 CTCAAGCTGGTGCCTCTTCTA 59.448 52.381 0.00 0.00 40.80 2.10
839 851 6.984740 TTATTTTTAAGTTCAACTGCAGCG 57.015 33.333 15.27 5.38 0.00 5.18
875 887 6.012858 TGGTGGAGTAATGAATTAACTGTCCT 60.013 38.462 0.00 0.00 0.00 3.85
1131 1147 0.031857 CGTGCCTTGACCATGCAAAA 59.968 50.000 0.00 0.00 36.65 2.44
1617 1738 4.313277 TGATTGTTTGCATTCCGTTGAA 57.687 36.364 0.00 0.00 34.33 2.69
1792 1915 8.001881 TCACTAATTTCAGTTGGCTTTTGTTA 57.998 30.769 0.00 0.00 0.00 2.41
1897 2021 4.023707 GTGCCCACTAATCATATTGCAGTC 60.024 45.833 0.00 0.00 0.00 3.51
2271 2401 2.234661 CTGGTGAACCATCTGCTCTGTA 59.765 50.000 1.88 0.00 46.46 2.74
2479 2970 4.967442 TCATGATCAGAAAGGAGAGTGGAT 59.033 41.667 0.09 0.00 0.00 3.41
2675 3167 6.002062 GCACTAACTGCATGAAGTTAACTT 57.998 37.500 23.71 20.67 46.29 2.66
2693 3185 2.289444 GGACTGCCAGTTAACTGCACTA 60.289 50.000 27.05 12.86 42.47 2.74
2765 3258 6.932400 TCTTCGAGGAAGTTAACTGCATTTTA 59.068 34.615 15.68 0.00 40.24 1.52


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.