Multiple sequence alignment - TraesCS1B01G189500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G189500 chr1B 100.000 3332 0 0 1 3332 339904544 339907875 0.000000e+00 6154.0
1 TraesCS1B01G189500 chr1B 99.340 3332 22 0 1 3332 338884689 338881358 0.000000e+00 6032.0
2 TraesCS1B01G189500 chr1B 99.062 1600 15 0 61 1660 339077782 339076183 0.000000e+00 2872.0
3 TraesCS1B01G189500 chr1B 86.672 1373 168 7 996 2356 332804508 332803139 0.000000e+00 1507.0
4 TraesCS1B01G189500 chr1B 92.466 292 16 4 2421 2711 332803035 332802749 2.390000e-111 412.0
5 TraesCS1B01G189500 chr1D 87.206 1360 161 4 996 2344 241242609 241243966 0.000000e+00 1535.0
6 TraesCS1B01G189500 chr1D 90.385 364 20 7 2352 2712 241244032 241244383 6.510000e-127 464.0
7 TraesCS1B01G189500 chr1D 85.159 283 28 5 3057 3332 241258776 241259051 9.100000e-71 278.0
8 TraesCS1B01G189500 chr1A 85.005 1087 139 11 972 2047 306136733 306137806 0.000000e+00 1083.0
9 TraesCS1B01G189500 chr1A 91.613 155 13 0 2421 2575 306143644 306143798 7.240000e-52 215.0
10 TraesCS1B01G189500 chr6D 95.950 321 13 0 67 387 336835630 336835310 3.810000e-144 521.0
11 TraesCS1B01G189500 chr6B 93.529 340 20 2 61 399 42818323 42817985 3.840000e-139 505.0
12 TraesCS1B01G189500 chr6B 95.312 64 1 2 3 65 651933115 651933053 2.120000e-17 100.0
13 TraesCS1B01G189500 chr5A 91.793 329 23 2 61 387 601238905 601239231 3.920000e-124 455.0
14 TraesCS1B01G189500 chr5D 91.541 331 23 3 61 387 298138109 298138438 5.070000e-123 451.0
15 TraesCS1B01G189500 chr6A 91.437 327 26 1 61 387 555581293 555581617 6.560000e-122 448.0
16 TraesCS1B01G189500 chr6A 91.265 332 23 4 61 387 599215974 599215644 6.560000e-122 448.0
17 TraesCS1B01G189500 chr2A 90.432 324 28 3 67 389 398762692 398762371 1.110000e-114 424.0
18 TraesCS1B01G189500 chr2B 100.000 60 0 0 3 62 801252632 801252691 9.770000e-21 111.0
19 TraesCS1B01G189500 chr2B 98.333 60 1 0 3 62 745432133 745432074 4.550000e-19 106.0
20 TraesCS1B01G189500 chr2B 95.238 63 3 0 3 65 197590638 197590576 2.120000e-17 100.0
21 TraesCS1B01G189500 chr4A 98.333 60 1 0 3 62 690225031 690225090 4.550000e-19 106.0
22 TraesCS1B01G189500 chr7B 95.312 64 3 0 3 66 588241219 588241156 5.880000e-18 102.0
23 TraesCS1B01G189500 chr2D 96.721 61 2 0 3 63 520149735 520149795 5.880000e-18 102.0
24 TraesCS1B01G189500 chr3B 93.846 65 2 2 3 66 813767930 813767993 2.740000e-16 97.1


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G189500 chr1B 339904544 339907875 3331 False 6154.0 6154 100.0000 1 3332 1 chr1B.!!$F1 3331
1 TraesCS1B01G189500 chr1B 338881358 338884689 3331 True 6032.0 6032 99.3400 1 3332 1 chr1B.!!$R1 3331
2 TraesCS1B01G189500 chr1B 339076183 339077782 1599 True 2872.0 2872 99.0620 61 1660 1 chr1B.!!$R2 1599
3 TraesCS1B01G189500 chr1B 332802749 332804508 1759 True 959.5 1507 89.5690 996 2711 2 chr1B.!!$R3 1715
4 TraesCS1B01G189500 chr1D 241242609 241244383 1774 False 999.5 1535 88.7955 996 2712 2 chr1D.!!$F2 1716
5 TraesCS1B01G189500 chr1A 306136733 306137806 1073 False 1083.0 1083 85.0050 972 2047 1 chr1A.!!$F1 1075

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1181 1182 2.434774 GGAGGTGTCCCGCCTTTT 59.565 61.111 0.0 0.0 45.19 2.27 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2668 2760 0.320374 CTCGGTGGTAGAAGGTGCAA 59.68 55.0 0.0 0.0 0.0 4.08 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1181 1182 2.434774 GGAGGTGTCCCGCCTTTT 59.565 61.111 0.00 0.0 45.19 2.27
1228 1229 2.101415 CAGTCCCATAGCTTCGACATCA 59.899 50.000 0.00 0.0 0.00 3.07
2089 2099 2.397597 TCAGCATGTATGAGCCCAGTA 58.602 47.619 0.00 0.0 37.40 2.74
2668 2760 2.694628 TGCAATTTCCAGCAAGTCAAGT 59.305 40.909 0.00 0.0 37.90 3.16
2975 3067 3.384146 CCATTTATATGGCACTGCACCAA 59.616 43.478 2.82 0.0 44.64 3.67
3140 3232 1.135972 GCACATTTGCTACCTCACACG 60.136 52.381 0.00 0.0 46.17 4.49
3206 3298 8.604640 TTGCATTACAAAACAATTGACATCAT 57.395 26.923 13.59 0.0 34.56 2.45
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
22 23 1.664874 GCAAATTGGGTTTCGTCGGTC 60.665 52.381 0.00 0.00 0.00 4.79
27 28 9.581099 CTAATAATAAAGCAAATTGGGTTTCGT 57.419 29.630 13.18 5.82 39.10 3.85
307 308 4.763073 AGTTGTAGTCGCCCCTTTAATAC 58.237 43.478 0.00 0.00 0.00 1.89
309 310 3.994931 AGTTGTAGTCGCCCCTTTAAT 57.005 42.857 0.00 0.00 0.00 1.40
370 371 1.139058 GATCACTAGATGTTGGGGCGT 59.861 52.381 0.00 0.00 33.72 5.68
381 382 5.046878 TGGCGTCCTTTTAAAGATCACTAGA 60.047 40.000 6.24 0.00 0.00 2.43
1181 1182 1.562942 AGCCTTCATCCATCTGCAGAA 59.437 47.619 22.50 4.47 0.00 3.02
1850 1857 4.457603 TGACAAATTTCATAACCTCACCCG 59.542 41.667 0.00 0.00 0.00 5.28
2089 2099 4.717877 TGCCCGATCATGAAGTAAATGAT 58.282 39.130 0.00 0.00 45.32 2.45
2668 2760 0.320374 CTCGGTGGTAGAAGGTGCAA 59.680 55.000 0.00 0.00 0.00 4.08
3140 3232 5.638234 GTGATTGTCAGGTACAGTTAAGACC 59.362 44.000 0.00 0.00 39.87 3.85
3206 3298 9.725206 ACTAATAAAATTAGGTCAGACCCTCTA 57.275 33.333 16.72 0.00 39.75 2.43


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.