Multiple sequence alignment - TraesCS1B01G189100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G189100 chr1B 100.000 2564 0 0 1 2564 338940367 338942930 0 4735
1 TraesCS1B01G189100 chr1B 97.310 2565 64 5 1 2564 135080909 135083469 0 4349
2 TraesCS1B01G189100 chr7B 98.207 2565 42 4 1 2564 716814718 716812157 0 4479
3 TraesCS1B01G189100 chr7B 96.532 2566 84 5 1 2564 417294385 417291823 0 4241
4 TraesCS1B01G189100 chr5B 98.051 2565 45 5 1 2564 127837908 127835348 0 4455
5 TraesCS1B01G189100 chr1D 97.505 2565 61 3 1 2564 351088819 351091381 0 4379
6 TraesCS1B01G189100 chr6B 96.686 2565 81 4 1 2564 264849654 264852215 0 4263
7 TraesCS1B01G189100 chr6B 97.033 2494 72 2 1 2494 625518381 625520872 0 4194


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G189100 chr1B 338940367 338942930 2563 False 4735 4735 100.000 1 2564 1 chr1B.!!$F2 2563
1 TraesCS1B01G189100 chr1B 135080909 135083469 2560 False 4349 4349 97.310 1 2564 1 chr1B.!!$F1 2563
2 TraesCS1B01G189100 chr7B 716812157 716814718 2561 True 4479 4479 98.207 1 2564 1 chr7B.!!$R2 2563
3 TraesCS1B01G189100 chr7B 417291823 417294385 2562 True 4241 4241 96.532 1 2564 1 chr7B.!!$R1 2563
4 TraesCS1B01G189100 chr5B 127835348 127837908 2560 True 4455 4455 98.051 1 2564 1 chr5B.!!$R1 2563
5 TraesCS1B01G189100 chr1D 351088819 351091381 2562 False 4379 4379 97.505 1 2564 1 chr1D.!!$F1 2563
6 TraesCS1B01G189100 chr6B 264849654 264852215 2561 False 4263 4263 96.686 1 2564 1 chr6B.!!$F1 2563
7 TraesCS1B01G189100 chr6B 625518381 625520872 2491 False 4194 4194 97.033 1 2494 1 chr6B.!!$F2 2493

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
501 502 0.829990 TCTGGCTGACCGATATTGCA 59.170 50.000 0.00 0.0 39.7 4.08 F
817 818 2.094078 CACATGTGGATTGGCGGATTTT 60.094 45.455 18.51 0.0 0.0 1.82 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1561 1567 2.507484 CTGTGCCCACAAGAAATCTCA 58.493 47.619 2.45 0.0 41.33 3.27 R
2397 2405 2.732619 GGCGGAGATCGGGGAAAGT 61.733 63.158 0.00 0.0 39.69 2.66 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
159 160 8.442374 AGGTTAAGAAAATAATAATAGGGCGGA 58.558 33.333 0.00 0.00 0.00 5.54
357 358 8.962884 TTCCTCATGAATTTATCTTGAATCGA 57.037 30.769 0.00 0.00 40.52 3.59
463 464 1.614903 TGACTTTTCGCGGAGGACTAA 59.385 47.619 6.13 0.00 0.00 2.24
501 502 0.829990 TCTGGCTGACCGATATTGCA 59.170 50.000 0.00 0.00 39.70 4.08
690 691 6.216569 TGCTCAATTATCTCTTAACCTAGCG 58.783 40.000 0.00 0.00 0.00 4.26
817 818 2.094078 CACATGTGGATTGGCGGATTTT 60.094 45.455 18.51 0.00 0.00 1.82
826 827 5.888724 TGGATTGGCGGATTTTTAATAGTCA 59.111 36.000 0.00 0.00 0.00 3.41
889 890 5.907866 TGATCCAACTACTCGATACAACA 57.092 39.130 0.00 0.00 0.00 3.33
1141 1142 5.107065 GGTGCAACAACAAGTACTAGCTTAG 60.107 44.000 0.00 0.00 39.98 2.18
1146 1147 4.235360 CAACAAGTACTAGCTTAGCGTGT 58.765 43.478 0.00 4.51 0.00 4.49
1502 1506 2.736670 ATAAGTGATCAAGGGGTGGC 57.263 50.000 0.00 0.00 0.00 5.01
1561 1567 5.514274 CATTACGATTAATGGGTGGCTTT 57.486 39.130 2.36 0.00 40.67 3.51
1599 1605 1.674441 CAGGCATCGCAAGTCATTCAT 59.326 47.619 0.00 0.00 39.48 2.57
1600 1606 2.874086 CAGGCATCGCAAGTCATTCATA 59.126 45.455 0.00 0.00 39.48 2.15
1601 1607 3.501062 CAGGCATCGCAAGTCATTCATAT 59.499 43.478 0.00 0.00 39.48 1.78
1602 1608 4.692155 CAGGCATCGCAAGTCATTCATATA 59.308 41.667 0.00 0.00 39.48 0.86
1632 1638 6.487668 TGGTTCTTCATTATCTGCATATGGTG 59.512 38.462 4.56 0.00 0.00 4.17
1798 1805 4.465632 TGAGCATTATACAAGGACGTGT 57.534 40.909 0.00 0.00 35.43 4.49
1999 2007 7.624360 GGTATTTCTACCACACATGATTTCA 57.376 36.000 0.00 0.00 45.88 2.69
2184 2192 3.432608 CCATTTGGGATCCTCATTTTGGC 60.433 47.826 12.58 0.00 40.01 4.52
2223 2231 3.589988 CTTTACTCGATGAGTTGGCTGT 58.410 45.455 4.60 0.00 40.28 4.40
2397 2405 4.689612 AGTAGCTGTCTGAGTTTTTCCA 57.310 40.909 0.00 0.00 0.00 3.53
2495 2503 4.252010 TCTATCCATAGAGACCTCCTCCA 58.748 47.826 0.00 0.00 42.97 3.86
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
159 160 6.262193 GCTATAGAGCCGAGTCTAAGAAAT 57.738 41.667 3.21 0.00 43.49 2.17
357 358 4.767409 GGATAAAGTTGAGCCAAAAGGTCT 59.233 41.667 0.00 0.00 43.71 3.85
463 464 1.553704 GAGACCACCGGTTACTGGATT 59.446 52.381 18.24 0.00 35.25 3.01
690 691 3.760580 ATGGTTGTAGAGCCTAGCATC 57.239 47.619 0.00 0.00 0.00 3.91
889 890 6.430308 TGTCTAAGGACGCGATCTAATAGATT 59.570 38.462 15.93 0.00 44.83 2.40
951 952 9.981114 CCAAAACTGTGAAAACCTAGAAATATT 57.019 29.630 0.00 0.00 0.00 1.28
1146 1147 1.378911 TACTAACTCGCCGCCTCCA 60.379 57.895 0.00 0.00 0.00 3.86
1502 1506 5.755849 AGTTTCCCCCTGTAATATGAGTTG 58.244 41.667 0.00 0.00 0.00 3.16
1561 1567 2.507484 CTGTGCCCACAAGAAATCTCA 58.493 47.619 2.45 0.00 41.33 3.27
1798 1805 6.027482 AGAAGGTAATGGGTTACTCCTACAA 58.973 40.000 0.00 0.00 40.06 2.41
1987 1995 7.888424 TCATCATGACTTTTGAAATCATGTGT 58.112 30.769 16.62 8.09 46.45 3.72
2020 2028 7.745620 AAATGTTCTGATAAAGACGTTCCTT 57.254 32.000 0.00 0.00 33.46 3.36
2223 2231 5.809001 AGAAGACAACAAGATTATGGCAGA 58.191 37.500 0.00 0.00 0.00 4.26
2397 2405 2.732619 GGCGGAGATCGGGGAAAGT 61.733 63.158 0.00 0.00 39.69 2.66


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.