Multiple sequence alignment - TraesCS1B01G188900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G188900 chr1B 100.000 3080 0 0 1 3080 338895402 338898481 0 5688
1 TraesCS1B01G188900 chr1B 98.313 3082 50 2 1 3080 683731561 683728480 0 5402
2 TraesCS1B01G188900 chr1B 98.151 3083 52 4 1 3080 338951745 338954825 0 5373
3 TraesCS1B01G188900 chr7B 98.214 3079 53 2 1 3077 698142742 698145820 0 5380
4 TraesCS1B01G188900 chr6B 98.021 3083 58 3 1 3080 128914697 128917779 0 5352
5 TraesCS1B01G188900 chr5B 97.794 3083 65 3 1 3080 713079639 713076557 0 5313
6 TraesCS1B01G188900 chr5B 97.763 3084 64 5 1 3080 713129075 713132157 0 5308


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G188900 chr1B 338895402 338898481 3079 False 5688 5688 100.000 1 3080 1 chr1B.!!$F1 3079
1 TraesCS1B01G188900 chr1B 683728480 683731561 3081 True 5402 5402 98.313 1 3080 1 chr1B.!!$R1 3079
2 TraesCS1B01G188900 chr1B 338951745 338954825 3080 False 5373 5373 98.151 1 3080 1 chr1B.!!$F2 3079
3 TraesCS1B01G188900 chr7B 698142742 698145820 3078 False 5380 5380 98.214 1 3077 1 chr7B.!!$F1 3076
4 TraesCS1B01G188900 chr6B 128914697 128917779 3082 False 5352 5352 98.021 1 3080 1 chr6B.!!$F1 3079
5 TraesCS1B01G188900 chr5B 713076557 713079639 3082 True 5313 5313 97.794 1 3080 1 chr5B.!!$R1 3079
6 TraesCS1B01G188900 chr5B 713129075 713132157 3082 False 5308 5308 97.763 1 3080 1 chr5B.!!$F1 3079

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
173 174 1.037030 CCCCTGCAATAATGGTGCGT 61.037 55.000 0.00 0.00 45.27 5.24 F
695 699 2.759973 TTCATCGGGAGGCTCGCT 60.760 61.111 26.29 8.63 0.00 4.93 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1801 1807 0.760945 CGGCTCAGGACCTCCCTATT 60.761 60.0 0.0 0.0 45.6 1.73 R
2372 2379 0.182299 CCTCCCTTCCATCCTCAAGC 59.818 60.0 0.0 0.0 0.0 4.01 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
173 174 1.037030 CCCCTGCAATAATGGTGCGT 61.037 55.000 0.00 0.00 45.27 5.24
695 699 2.759973 TTCATCGGGAGGCTCGCT 60.760 61.111 26.29 8.63 0.00 4.93
740 744 6.855763 AAAGGATAAGTTGCATTGGAATCA 57.144 33.333 0.00 0.00 0.00 2.57
1433 1438 8.301002 GTCATCTCTTCCAATAGATGTACTACC 58.699 40.741 12.13 0.00 46.06 3.18
1476 1482 6.726490 ATCTTAATGCGGGAGTTTCTAGTA 57.274 37.500 0.00 0.00 0.00 1.82
1801 1807 7.211573 ACATCTCTTTTTGCAACATCAATTCA 58.788 30.769 0.00 0.00 0.00 2.57
2257 2264 7.217906 AGAATCTTACGTCCTTGAGAAAAGTT 58.782 34.615 0.00 0.00 0.00 2.66
2372 2379 5.501156 ACTAAGGCATCAAGGAAAGTAAGG 58.499 41.667 0.00 0.00 0.00 2.69
2548 2555 1.004918 GACCCATTCTATCCGGGCG 60.005 63.158 0.00 0.00 44.49 6.13
2688 2695 6.553852 GGATCTAATAGTCCACTTCACCCTAA 59.446 42.308 0.00 0.00 34.57 2.69
2810 2817 2.172679 GAGGGAGAGAAGACGGTTCTT 58.827 52.381 4.02 0.00 45.35 2.52
2977 2984 1.398739 CTGATTCTGCTGCAGCTTGAG 59.601 52.381 36.61 26.21 42.66 3.02
3057 3064 7.229506 AGCTTTACTGAAGTACTGCAAGAAAAT 59.770 33.333 4.75 0.00 37.69 1.82
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
695 699 7.439056 CCTTTAGGAGTTGACGTAACAAACTAA 59.561 37.037 0.00 0.0 41.88 2.24
740 744 9.906660 TTATGCAATTATGAACGAAACTTTCTT 57.093 25.926 0.00 0.0 0.00 2.52
1476 1482 9.892130 AATCTAGACGGAAGATTGTTTCTTATT 57.108 29.630 0.00 0.0 44.88 1.40
1801 1807 0.760945 CGGCTCAGGACCTCCCTATT 60.761 60.000 0.00 0.0 45.60 1.73
1953 1959 1.666553 GCCACCACGTTCGATCACA 60.667 57.895 0.00 0.0 0.00 3.58
2257 2264 9.901172 GACATTACTTCCCTTTCCTATCTTTTA 57.099 33.333 0.00 0.0 0.00 1.52
2372 2379 0.182299 CCTCCCTTCCATCCTCAAGC 59.818 60.000 0.00 0.0 0.00 4.01
2548 2555 6.803807 GTGAATTCTGAAACTCCAGCATTTAC 59.196 38.462 7.05 0.0 31.85 2.01
2810 2817 0.034380 AGAGATGTCTTCCGTCCCGA 60.034 55.000 0.00 0.0 0.00 5.14
2861 2868 3.181440 TGCTCAGTTTCATCCCTTTCTGT 60.181 43.478 0.00 0.0 0.00 3.41
2977 2984 3.149196 TCAGCATTTTCACAGGTCCTTC 58.851 45.455 0.00 0.0 0.00 3.46


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.