Multiple sequence alignment - TraesCS1B01G188800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G188800 chr1B 100.000 2830 0 0 1 2830 338892818 338895647 0 5227
1 TraesCS1B01G188800 chr1B 98.728 2830 32 3 1 2830 683734141 683731316 0 5024
2 TraesCS1B01G188800 chr1B 98.093 2831 49 5 1 2830 583536770 583533944 0 4924
3 TraesCS1B01G188800 chrUn 98.869 2830 30 2 1 2830 223706933 223704106 0 5048
4 TraesCS1B01G188800 chrUn 98.481 2830 41 2 1 2830 40085860 40088687 0 4987
5 TraesCS1B01G188800 chr2A 98.833 2827 30 3 1 2827 605912876 605910053 0 5035
6 TraesCS1B01G188800 chr2A 98.021 2830 51 3 1 2830 563256643 563259467 0 4911
7 TraesCS1B01G188800 chr7B 98.657 2830 35 3 1 2830 698140161 698142987 0 5012
8 TraesCS1B01G188800 chr5B 98.339 2830 41 4 1 2830 713082217 713079394 0 4961
9 TraesCS1B01G188800 chr5B 97.880 2830 51 8 1 2830 713126500 713129320 0 4885


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G188800 chr1B 338892818 338895647 2829 False 5227 5227 100.000 1 2830 1 chr1B.!!$F1 2829
1 TraesCS1B01G188800 chr1B 683731316 683734141 2825 True 5024 5024 98.728 1 2830 1 chr1B.!!$R2 2829
2 TraesCS1B01G188800 chr1B 583533944 583536770 2826 True 4924 4924 98.093 1 2830 1 chr1B.!!$R1 2829
3 TraesCS1B01G188800 chrUn 223704106 223706933 2827 True 5048 5048 98.869 1 2830 1 chrUn.!!$R1 2829
4 TraesCS1B01G188800 chrUn 40085860 40088687 2827 False 4987 4987 98.481 1 2830 1 chrUn.!!$F1 2829
5 TraesCS1B01G188800 chr2A 605910053 605912876 2823 True 5035 5035 98.833 1 2827 1 chr2A.!!$R1 2826
6 TraesCS1B01G188800 chr2A 563256643 563259467 2824 False 4911 4911 98.021 1 2830 1 chr2A.!!$F1 2829
7 TraesCS1B01G188800 chr7B 698140161 698142987 2826 False 5012 5012 98.657 1 2830 1 chr7B.!!$F1 2829
8 TraesCS1B01G188800 chr5B 713079394 713082217 2823 True 4961 4961 98.339 1 2830 1 chr5B.!!$R1 2829
9 TraesCS1B01G188800 chr5B 713126500 713129320 2820 False 4885 4885 97.880 1 2830 1 chr5B.!!$F1 2829

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
175 176 2.023695 ACTCCTTTCCATGGCCATTCAT 60.024 45.455 17.92 0.0 0.0 2.57 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1845 1850 1.227853 GCGGCGGGATTGAATACCT 60.228 57.895 9.78 0.0 0.0 3.08 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
73 74 2.347500 TCAGCCCATAGCCCAATATCA 58.653 47.619 0.00 0.0 45.47 2.15
136 137 3.632145 TCATCGTCCAATCTTCTCGATCA 59.368 43.478 0.00 0.0 38.82 2.92
175 176 2.023695 ACTCCTTTCCATGGCCATTCAT 60.024 45.455 17.92 0.0 0.00 2.57
763 765 5.367945 AAAGGAAGGGTTCGAATAGCATA 57.632 39.130 0.00 0.0 0.00 3.14
863 865 6.463995 AAGTAACAAATCTTTCTTGGCACA 57.536 33.333 0.00 0.0 0.00 4.57
877 879 3.047807 GCACATGCCCCTGCTCCTA 62.048 63.158 0.00 0.0 38.71 2.94
925 927 4.083565 GGCAACATAGGTACCCTTTTTCA 58.916 43.478 8.74 0.0 34.61 2.69
940 942 2.873170 TTTCAGTATGCGTTGCGAAG 57.127 45.000 0.00 0.0 34.76 3.79
962 964 6.229561 AGACTTTCATTTTTAGCGTCTCAC 57.770 37.500 0.00 0.0 0.00 3.51
987 989 3.130164 TCTCTGGAGAAGCTCAAATCGAG 59.870 47.826 0.00 0.0 38.50 4.04
1258 1261 2.976882 AGCCGCCCTATTCTATTACCAA 59.023 45.455 0.00 0.0 0.00 3.67
1783 1788 0.530650 CCGATGGCTTATGTGCGACT 60.531 55.000 0.00 0.0 0.00 4.18
1786 1791 0.734889 ATGGCTTATGTGCGACTTGC 59.265 50.000 0.00 0.0 46.70 4.01
1845 1850 2.735444 GCGTGAACTCTGATTCGATCCA 60.735 50.000 0.00 0.0 0.00 3.41
2014 2019 1.683385 CTGACCACACTGAGAGACACA 59.317 52.381 0.00 0.0 0.00 3.72
2090 2095 3.799420 GCAAAGAGAGGTCGTGATGATAC 59.201 47.826 0.00 0.0 0.00 2.24
2091 2096 4.678044 GCAAAGAGAGGTCGTGATGATACA 60.678 45.833 0.00 0.0 0.00 2.29
2258 2263 0.886490 GCCCGGGTCAGCATAGAATG 60.886 60.000 24.63 0.0 0.00 2.67
2416 2421 1.375523 GTGTCCGAGCCGATTGGTT 60.376 57.895 0.00 0.0 37.67 3.67
2597 2604 3.505836 GCAATAAGCTTGCTTCTTCACC 58.494 45.455 9.86 0.0 41.87 4.02
2603 2610 1.339291 GCTTGCTTCTTCACCAGCTTT 59.661 47.619 0.00 0.0 36.92 3.51
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
73 74 5.652452 GGTTTGAATAATAGGCTGTGGTCTT 59.348 40.000 0.00 0.0 0.00 3.01
175 176 2.435938 GTTGATCTTCGCGGGCCA 60.436 61.111 6.13 0.0 0.00 5.36
863 865 0.327000 AAGACTAGGAGCAGGGGCAT 60.327 55.000 0.00 0.0 44.61 4.40
877 879 7.171630 ACCATTAATGACTAGTTCGAAGACT 57.828 36.000 17.23 0.0 34.32 3.24
925 927 2.080286 AAGTCTTCGCAACGCATACT 57.920 45.000 0.00 0.0 0.00 2.12
940 942 5.179555 AGGTGAGACGCTAAAAATGAAAGTC 59.820 40.000 0.00 0.0 0.00 3.01
987 989 0.037790 GGACCATCTGCTCTATCCGC 60.038 60.000 0.00 0.0 0.00 5.54
1258 1261 4.704057 GGATGAGCTTCTCTCCATTTTGTT 59.296 41.667 0.00 0.0 41.18 2.83
1845 1850 1.227853 GCGGCGGGATTGAATACCT 60.228 57.895 9.78 0.0 0.00 3.08
2416 2421 1.799544 TGTGCAGTAGTCGTCGTCTA 58.200 50.000 0.00 0.0 0.00 2.59


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.