Multiple sequence alignment - TraesCS1B01G188700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G188700 chr1B 100.000 3296 0 0 1 3296 338884653 338881358 0.000000e+00 6087.0
1 TraesCS1B01G188700 chr1B 99.393 3296 20 0 1 3296 339904580 339907875 0.000000e+00 5976.0
2 TraesCS1B01G188700 chr1B 99.312 1600 11 0 25 1624 339077782 339076183 0.000000e+00 2894.0
3 TraesCS1B01G188700 chr1B 86.890 1373 165 7 960 2320 332804508 332803139 0.000000e+00 1524.0
4 TraesCS1B01G188700 chr1B 92.466 292 16 4 2385 2675 332803035 332802749 2.370000e-111 412.0
5 TraesCS1B01G188700 chr1D 87.279 1360 160 4 960 2308 241242609 241243966 0.000000e+00 1541.0
6 TraesCS1B01G188700 chr1D 90.659 364 19 7 2316 2676 241244032 241244383 1.380000e-128 470.0
7 TraesCS1B01G188700 chr1A 85.097 1087 138 11 936 2011 306136733 306137806 0.000000e+00 1088.0
8 TraesCS1B01G188700 chr1A 89.109 303 29 2 2006 2308 306143233 306143531 1.120000e-99 374.0
9 TraesCS1B01G188700 chr1A 90.968 155 14 0 2385 2539 306143644 306143798 3.330000e-50 209.0
10 TraesCS1B01G188700 chr6D 96.262 321 12 0 31 351 336835630 336835310 8.100000e-146 527.0
11 TraesCS1B01G188700 chr6B 93.824 340 19 2 25 363 42818323 42817985 8.160000e-141 510.0
12 TraesCS1B01G188700 chr6B 100.000 29 0 0 1 29 651933081 651933053 2.000000e-03 54.7
13 TraesCS1B01G188700 chr5A 92.705 329 20 2 25 351 601238905 601239231 3.850000e-129 472.0
14 TraesCS1B01G188700 chr5D 92.145 331 21 3 25 351 298138109 298138438 2.320000e-126 462.0
15 TraesCS1B01G188700 chr6A 91.867 332 21 4 25 351 599215974 599215644 3.000000e-125 459.0
16 TraesCS1B01G188700 chr6A 91.743 327 25 1 25 351 555581293 555581617 1.390000e-123 453.0
17 TraesCS1B01G188700 chr2A 91.667 324 24 3 31 353 398762692 398762371 2.330000e-121 446.0
18 TraesCS1B01G188700 chr5B 100.000 28 0 0 1 28 167286857 167286884 6.000000e-03 52.8


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G188700 chr1B 338881358 338884653 3295 True 6087.0 6087 100.0000 1 3296 1 chr1B.!!$R1 3295
1 TraesCS1B01G188700 chr1B 339904580 339907875 3295 False 5976.0 5976 99.3930 1 3296 1 chr1B.!!$F1 3295
2 TraesCS1B01G188700 chr1B 339076183 339077782 1599 True 2894.0 2894 99.3120 25 1624 1 chr1B.!!$R2 1599
3 TraesCS1B01G188700 chr1B 332802749 332804508 1759 True 968.0 1524 89.6780 960 2675 2 chr1B.!!$R3 1715
4 TraesCS1B01G188700 chr1D 241242609 241244383 1774 False 1005.5 1541 88.9690 960 2676 2 chr1D.!!$F1 1716
5 TraesCS1B01G188700 chr1A 306136733 306137806 1073 False 1088.0 1088 85.0970 936 2011 1 chr1A.!!$F1 1075
6 TraesCS1B01G188700 chr1A 306143233 306143798 565 False 291.5 374 90.0385 2006 2539 2 chr1A.!!$F2 533

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1262 1263 1.014564 GTGCCAGGCTACGAGAACAC 61.015 60.0 14.15 0.0 0.0 3.32 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2492 2584 2.744202 GGTCACAGCCAACTAACATCTG 59.256 50.0 0.0 0.0 0.0 2.9 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1262 1263 1.014564 GTGCCAGGCTACGAGAACAC 61.015 60.000 14.15 0.0 0.00 3.32
2939 3034 3.243501 CCATTTATATGGCACTGCACCAC 60.244 47.826 2.82 0.0 44.64 4.16
3104 3199 1.879380 GCACATTTGCTACCTCACACA 59.121 47.619 0.00 0.0 46.17 3.72
3170 3265 7.405469 TGCATTACAAAACAATTGACATCAC 57.595 32.000 13.59 0.0 0.00 3.06
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
561 562 8.467963 TCCAACAAATGATGTATATTGAGCAT 57.532 30.769 0.00 0.0 42.99 3.79
1222 1223 6.211584 GGCACAAGGATAGGATAACTCATCTA 59.788 42.308 0.00 0.0 33.78 1.98
1262 1263 2.163509 AGTAGTCGATCATCGGGATGG 58.836 52.381 7.33 0.0 40.88 3.51
2492 2584 2.744202 GGTCACAGCCAACTAACATCTG 59.256 50.000 0.00 0.0 0.00 2.90
3104 3199 6.041637 TGTGATTGTCAGGTACAGTTAAGACT 59.958 38.462 0.00 0.0 39.87 3.24
3170 3265 8.487028 ACTAATAAAATTAGGTCAGACCCTCTG 58.513 37.037 16.72 0.0 45.59 3.35


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.