Multiple sequence alignment - TraesCS1B01G181900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G181900 chr1B 100.000 2755 0 0 1 2755 328826925 328829679 0 5088
1 TraesCS1B01G181900 chr1B 98.678 983 13 0 1773 2755 508558689 508557707 0 1744
2 TraesCS1B01G181900 chr1B 98.474 983 15 0 1773 2755 549368573 549369555 0 1733
3 TraesCS1B01G181900 chr1B 98.468 979 15 0 1777 2755 330063671 330062693 0 1725
4 TraesCS1B01G181900 chr1B 98.271 983 17 0 1773 2755 30856850 30855868 0 1722
5 TraesCS1B01G181900 chr5B 98.246 1767 29 2 1 1767 624635033 624636797 0 3090
6 TraesCS1B01G181900 chr5B 97.906 1767 36 1 1 1767 341066587 341064822 0 3057
7 TraesCS1B01G181900 chr2A 98.189 1767 30 2 1 1767 475523621 475525385 0 3085
8 TraesCS1B01G181900 chr4A 98.131 1766 31 2 2 1767 37012126 37013889 0 3077
9 TraesCS1B01G181900 chr3A 98.076 1767 32 2 1 1767 102495511 102497275 0 3073
10 TraesCS1B01G181900 chr3B 97.963 1767 34 2 1 1767 166166920 166168684 0 3062
11 TraesCS1B01G181900 chr3B 98.369 981 16 0 1773 2753 59439306 59438326 0 1724
12 TraesCS1B01G181900 chr2B 97.793 1767 37 2 1 1767 91832186 91830422 0 3046
13 TraesCS1B01G181900 chr2B 97.793 1767 34 2 1 1767 195008848 195010609 0 3042
14 TraesCS1B01G181900 chr2B 98.474 983 15 0 1773 2755 23669793 23668811 0 1733
15 TraesCS1B01G181900 chr6B 97.736 1767 38 2 1 1767 77619832 77621596 0 3040
16 TraesCS1B01G181900 chr6B 98.271 983 17 0 1773 2755 77641158 77642140 0 1722
17 TraesCS1B01G181900 chr4B 98.678 983 13 0 1773 2755 518696208 518697190 0 1744
18 TraesCS1B01G181900 chr4B 98.372 983 16 0 1773 2755 141561011 141560029 0 1727


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G181900 chr1B 328826925 328829679 2754 False 5088 5088 100.000 1 2755 1 chr1B.!!$F1 2754
1 TraesCS1B01G181900 chr1B 508557707 508558689 982 True 1744 1744 98.678 1773 2755 1 chr1B.!!$R3 982
2 TraesCS1B01G181900 chr1B 549368573 549369555 982 False 1733 1733 98.474 1773 2755 1 chr1B.!!$F2 982
3 TraesCS1B01G181900 chr1B 330062693 330063671 978 True 1725 1725 98.468 1777 2755 1 chr1B.!!$R2 978
4 TraesCS1B01G181900 chr1B 30855868 30856850 982 True 1722 1722 98.271 1773 2755 1 chr1B.!!$R1 982
5 TraesCS1B01G181900 chr5B 624635033 624636797 1764 False 3090 3090 98.246 1 1767 1 chr5B.!!$F1 1766
6 TraesCS1B01G181900 chr5B 341064822 341066587 1765 True 3057 3057 97.906 1 1767 1 chr5B.!!$R1 1766
7 TraesCS1B01G181900 chr2A 475523621 475525385 1764 False 3085 3085 98.189 1 1767 1 chr2A.!!$F1 1766
8 TraesCS1B01G181900 chr4A 37012126 37013889 1763 False 3077 3077 98.131 2 1767 1 chr4A.!!$F1 1765
9 TraesCS1B01G181900 chr3A 102495511 102497275 1764 False 3073 3073 98.076 1 1767 1 chr3A.!!$F1 1766
10 TraesCS1B01G181900 chr3B 166166920 166168684 1764 False 3062 3062 97.963 1 1767 1 chr3B.!!$F1 1766
11 TraesCS1B01G181900 chr3B 59438326 59439306 980 True 1724 1724 98.369 1773 2753 1 chr3B.!!$R1 980
12 TraesCS1B01G181900 chr2B 91830422 91832186 1764 True 3046 3046 97.793 1 1767 1 chr2B.!!$R2 1766
13 TraesCS1B01G181900 chr2B 195008848 195010609 1761 False 3042 3042 97.793 1 1767 1 chr2B.!!$F1 1766
14 TraesCS1B01G181900 chr2B 23668811 23669793 982 True 1733 1733 98.474 1773 2755 1 chr2B.!!$R1 982
15 TraesCS1B01G181900 chr6B 77619832 77621596 1764 False 3040 3040 97.736 1 1767 1 chr6B.!!$F1 1766
16 TraesCS1B01G181900 chr6B 77641158 77642140 982 False 1722 1722 98.271 1773 2755 1 chr6B.!!$F2 982
17 TraesCS1B01G181900 chr4B 518696208 518697190 982 False 1744 1744 98.678 1773 2755 1 chr4B.!!$F1 982
18 TraesCS1B01G181900 chr4B 141560029 141561011 982 True 1727 1727 98.372 1773 2755 1 chr4B.!!$R1 982

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
988 991 4.137543 GGAGACACACACTTTCCATCTTT 58.862 43.478 0.0 0.0 0.0 2.52 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1999 2002 1.151668 CGGATCGGCATCAAGGAATC 58.848 55.0 0.0 0.0 0.0 2.52 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
901 904 5.308825 GACTTCTCCCTTTCATTCAGTTGA 58.691 41.667 0.00 0.00 0.00 3.18
988 991 4.137543 GGAGACACACACTTTCCATCTTT 58.862 43.478 0.00 0.00 0.00 2.52
1053 1056 1.133575 ACCGGTCTTCCTATCGATGGA 60.134 52.381 10.78 11.02 0.00 3.41
1156 1159 2.011540 GGAACCAGAAGTAGAAGGCG 57.988 55.000 0.00 0.00 0.00 5.52
1158 1161 2.168728 GGAACCAGAAGTAGAAGGCGAT 59.831 50.000 0.00 0.00 0.00 4.58
1221 1224 7.822334 TGGATTGTATCGAACTTCAGTAATTGT 59.178 33.333 0.00 0.00 0.00 2.71
1359 1362 2.370393 GGCGTTGACCGTCTTCGAC 61.370 63.158 15.95 11.35 38.41 4.20
1544 1547 2.627699 AGGTATTGGTGGTTGTTTGCTG 59.372 45.455 0.00 0.00 0.00 4.41
1767 1770 5.803461 CAGGTGAATTGACATTGCATAAGTG 59.197 40.000 0.00 0.00 0.00 3.16
1768 1771 5.104374 GGTGAATTGACATTGCATAAGTGG 58.896 41.667 0.00 0.00 0.00 4.00
1769 1772 5.104374 GTGAATTGACATTGCATAAGTGGG 58.896 41.667 0.00 0.00 0.00 4.61
1770 1773 5.015515 TGAATTGACATTGCATAAGTGGGA 58.984 37.500 0.00 0.00 0.00 4.37
1771 1774 5.657745 TGAATTGACATTGCATAAGTGGGAT 59.342 36.000 0.00 0.00 0.00 3.85
1793 1796 6.037610 GGATTGCGTATTGAGAAAGTCTTGAT 59.962 38.462 0.00 0.00 0.00 2.57
1867 1870 1.082690 GCTTCTCGGAGAAAGCAAGG 58.917 55.000 24.46 14.10 44.16 3.61
1999 2002 1.006832 CAATCTCCACCGCGTTAAGG 58.993 55.000 4.92 0.67 0.00 2.69
2217 2220 1.002142 CGTGCCATCAATTGCGATGAT 60.002 47.619 8.35 0.00 44.67 2.45
2500 2503 3.760684 AGATGGCTTTCACAAGGTCAATC 59.239 43.478 0.00 0.00 0.00 2.67
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
506 508 7.702386 TGTATCCAACCATATCAAATCAAACG 58.298 34.615 0.00 0.00 0.00 3.60
901 904 3.381983 TGGCGTCGACCTGCTGAT 61.382 61.111 10.58 0.00 0.00 2.90
988 991 2.365105 GGTCATCTCCCCGGTCCA 60.365 66.667 0.00 0.00 0.00 4.02
1053 1056 4.161565 TCGGTGCTCATACATAGAGGTTTT 59.838 41.667 0.00 0.00 33.72 2.43
1156 1159 3.553917 GCTGCGACTCTTTCCTTCTTATC 59.446 47.826 0.00 0.00 0.00 1.75
1158 1161 2.353803 GGCTGCGACTCTTTCCTTCTTA 60.354 50.000 0.00 0.00 0.00 2.10
1221 1224 2.968574 GTCCTCATTAGCATCCTCAGGA 59.031 50.000 0.00 0.00 35.55 3.86
1359 1362 1.273327 GAACCCCAACTCCATTTGCTG 59.727 52.381 0.00 0.00 0.00 4.41
1452 1455 7.669427 ACATGGTTGAATTAAAAGCAAGATCA 58.331 30.769 12.18 0.00 38.41 2.92
1544 1547 1.952296 CAGCTCCATATGGAAAGTGCC 59.048 52.381 24.54 9.66 44.91 5.01
1767 1770 4.192317 AGACTTTCTCAATACGCAATCCC 58.808 43.478 0.00 0.00 0.00 3.85
1768 1771 5.351465 TCAAGACTTTCTCAATACGCAATCC 59.649 40.000 0.00 0.00 0.00 3.01
1769 1772 6.408858 TCAAGACTTTCTCAATACGCAATC 57.591 37.500 0.00 0.00 0.00 2.67
1770 1773 6.037610 GGATCAAGACTTTCTCAATACGCAAT 59.962 38.462 0.00 0.00 0.00 3.56
1771 1774 5.351465 GGATCAAGACTTTCTCAATACGCAA 59.649 40.000 0.00 0.00 0.00 4.85
1793 1796 3.448469 AAAAACTTGATGCCGGGGA 57.552 47.368 2.18 0.00 0.00 4.81
1822 1825 5.000012 TCGCCACTTTGTACAACAAATTT 58.000 34.783 8.07 0.00 45.79 1.82
1867 1870 4.595116 CCGATGATCTTCAAGATTGTTGC 58.405 43.478 0.16 0.00 34.53 4.17
1999 2002 1.151668 CGGATCGGCATCAAGGAATC 58.848 55.000 0.00 0.00 0.00 2.52
2217 2220 2.343101 CTTTCGAACATTGTAGGCCGA 58.657 47.619 0.00 0.00 0.00 5.54
2500 2503 1.536766 ACAATGAGCGTCCAACATGTG 59.463 47.619 0.00 0.00 0.00 3.21


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.