Multiple sequence alignment - TraesCS1B01G180300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G180300 chr1B 100.000 3015 0 0 1 3015 327025298 327022284 0.000000e+00 5568.0
1 TraesCS1B01G180300 chr1B 95.780 1564 48 8 1 1558 435193422 435194973 0.000000e+00 2507.0
2 TraesCS1B01G180300 chr1B 94.900 1098 46 5 1651 2742 435195411 435196504 0.000000e+00 1709.0
3 TraesCS1B01G180300 chr1B 93.625 251 10 3 2769 3015 435309507 435309755 1.320000e-98 370.0
4 TraesCS1B01G180300 chr1B 100.000 35 0 0 1558 1592 435194997 435195031 6.980000e-07 65.8
5 TraesCS1B01G180300 chr1D 94.468 2784 114 18 1 2768 322284457 322287216 0.000000e+00 4252.0
6 TraesCS1B01G180300 chr1D 98.069 1605 24 4 1 1603 227131589 227129990 0.000000e+00 2785.0
7 TraesCS1B01G180300 chr1D 98.702 1387 16 1 1629 3015 227129637 227128253 0.000000e+00 2460.0
8 TraesCS1B01G180300 chr1D 95.276 254 11 1 2763 3015 322287254 322287507 4.680000e-108 401.0
9 TraesCS1B01G180300 chr1D 82.927 164 21 5 285 442 112443752 112443590 1.130000e-29 141.0
10 TraesCS1B01G180300 chr1D 83.465 127 9 7 501 622 112443583 112443464 1.140000e-19 108.0
11 TraesCS1B01G180300 chr1A 95.337 2509 77 13 115 2587 406188904 406191408 0.000000e+00 3949.0
12 TraesCS1B01G180300 chr1A 95.775 284 11 1 2733 3015 406203183 406203466 9.850000e-125 457.0
13 TraesCS1B01G180300 chr1A 93.750 128 7 1 2578 2704 406203055 406203182 1.100000e-44 191.0
14 TraesCS1B01G180300 chr3A 84.305 1389 146 30 692 2038 739735331 739733973 0.000000e+00 1291.0
15 TraesCS1B01G180300 chr3A 84.869 879 93 19 668 1539 739322282 739323127 0.000000e+00 850.0
16 TraesCS1B01G180300 chr3A 82.937 463 60 16 1560 2007 739323225 739323683 1.680000e-107 399.0
17 TraesCS1B01G180300 chr3A 87.313 134 7 5 505 637 739770403 739770279 8.710000e-31 145.0
18 TraesCS1B01G180300 chr3B 83.498 1418 159 30 667 2035 816692399 816691008 0.000000e+00 1253.0
19 TraesCS1B01G180300 chr3D 83.873 1358 152 30 720 2037 607310709 607309379 0.000000e+00 1232.0
20 TraesCS1B01G180300 chr3D 82.744 1414 159 39 667 2038 606929734 606931104 0.000000e+00 1181.0
21 TraesCS1B01G180300 chr3D 82.906 351 49 10 274 614 606929372 606929721 3.780000e-79 305.0
22 TraesCS1B01G180300 chrUn 84.252 127 8 6 501 622 101646669 101646550 2.460000e-21 113.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G180300 chr1B 327022284 327025298 3014 True 5568.000000 5568 100.000000 1 3015 1 chr1B.!!$R1 3014
1 TraesCS1B01G180300 chr1B 435193422 435196504 3082 False 1427.266667 2507 96.893333 1 2742 3 chr1B.!!$F2 2741
2 TraesCS1B01G180300 chr1D 227128253 227131589 3336 True 2622.500000 2785 98.385500 1 3015 2 chr1D.!!$R2 3014
3 TraesCS1B01G180300 chr1D 322284457 322287507 3050 False 2326.500000 4252 94.872000 1 3015 2 chr1D.!!$F1 3014
4 TraesCS1B01G180300 chr1A 406188904 406191408 2504 False 3949.000000 3949 95.337000 115 2587 1 chr1A.!!$F1 2472
5 TraesCS1B01G180300 chr3A 739733973 739735331 1358 True 1291.000000 1291 84.305000 692 2038 1 chr3A.!!$R1 1346
6 TraesCS1B01G180300 chr3A 739322282 739323683 1401 False 624.500000 850 83.903000 668 2007 2 chr3A.!!$F1 1339
7 TraesCS1B01G180300 chr3B 816691008 816692399 1391 True 1253.000000 1253 83.498000 667 2035 1 chr3B.!!$R1 1368
8 TraesCS1B01G180300 chr3D 607309379 607310709 1330 True 1232.000000 1232 83.873000 720 2037 1 chr3D.!!$R1 1317
9 TraesCS1B01G180300 chr3D 606929372 606931104 1732 False 743.000000 1181 82.825000 274 2038 2 chr3D.!!$F1 1764

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
662 693 3.660865 CAAAGGCTAACCGTCTTGTACT 58.339 45.455 0.00 0.0 37.69 2.73 F
1055 1107 1.974957 TGAGGAACCACGAGGATTTCA 59.025 47.619 5.68 0.0 38.69 2.69 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1940 2440 3.447586 TCTCTGTAAGAATAGCCGCTGTT 59.552 43.478 2.16 1.78 46.34 3.16 R
2314 2824 4.322057 AAAGAGTAGCAACCCCATCAAT 57.678 40.909 0.00 0.00 0.00 2.57 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
254 273 4.484236 CAGCCTATTGTGCAATCGAAAAA 58.516 39.130 0.18 0.00 32.50 1.94
262 281 4.428209 TGTGCAATCGAAAAACATGTGTT 58.572 34.783 0.00 0.00 40.50 3.32
470 495 6.241207 TCTGTAAGCCGAAAAGAAAATGAG 57.759 37.500 0.00 0.00 0.00 2.90
662 693 3.660865 CAAAGGCTAACCGTCTTGTACT 58.339 45.455 0.00 0.00 37.69 2.73
1055 1107 1.974957 TGAGGAACCACGAGGATTTCA 59.025 47.619 5.68 0.00 38.69 2.69
1105 1160 3.833070 AGAAAGGTCTATCTCACCACGTT 59.167 43.478 0.00 0.00 36.23 3.99
1853 2342 9.537192 CGAAATCTGTTGTGGTTAACCTATATA 57.463 33.333 24.78 8.44 36.82 0.86
1940 2440 1.350684 TGGGCTTGCAAGACATCTACA 59.649 47.619 32.60 18.42 35.04 2.74
2049 2558 2.972021 TCCTTGTCAGAGTTCATCACCA 59.028 45.455 0.00 0.00 0.00 4.17
2314 2824 0.320374 ATTGCTCTTTCGTGACCGGA 59.680 50.000 9.46 0.00 33.95 5.14
2419 2929 4.406648 AATGAGGACTGATGCGTATTCA 57.593 40.909 0.00 0.00 0.00 2.57
2505 3015 7.094549 CCTTTGTCATGTCCCGTCTTATTTTTA 60.095 37.037 0.00 0.00 0.00 1.52
2538 3052 1.000955 ACTTTGAGTGGTACTCCAGCG 59.999 52.381 6.52 0.00 44.44 5.18
2695 3214 3.283751 TGTCAAACTTGAACCGGAACAT 58.716 40.909 9.46 0.00 39.21 2.71
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
254 273 1.879380 AGTTGCACGCATAACACATGT 59.121 42.857 0.00 0.00 0.00 3.21
470 495 4.499865 GGGGAAGCTCTGAAAAACTGTTTC 60.500 45.833 6.20 0.00 0.00 2.78
1055 1107 0.558220 TCGAGGAGGAGGACCATCAT 59.442 55.000 0.00 0.00 38.94 2.45
1105 1160 1.599606 GACAGCTCTCCCTCGAAGCA 61.600 60.000 8.64 0.00 0.00 3.91
1940 2440 3.447586 TCTCTGTAAGAATAGCCGCTGTT 59.552 43.478 2.16 1.78 46.34 3.16
2049 2558 5.930135 AGGAACTTTGTCACAAGTACTGAT 58.070 37.500 0.00 0.00 27.25 2.90
2314 2824 4.322057 AAAGAGTAGCAACCCCATCAAT 57.678 40.909 0.00 0.00 0.00 2.57
2538 3052 7.586300 CGAAATACGAACATGTAAATTGGGATC 59.414 37.037 0.00 0.00 45.77 3.36
2695 3214 4.435425 CGTCCGAAGTTTATATGGGTTCA 58.565 43.478 0.00 0.00 0.00 3.18


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.