Multiple sequence alignment - TraesCS1B01G172600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G172600 chr1B 100.000 2549 0 0 1 2549 307939137 307941685 0.000000e+00 4708
1 TraesCS1B01G172600 chr1B 96.927 1985 54 5 569 2549 616703966 616701985 0.000000e+00 3321
2 TraesCS1B01G172600 chr1B 95.998 1749 63 6 565 2310 561526125 561527869 0.000000e+00 2835
3 TraesCS1B01G172600 chr1B 95.936 1747 61 7 567 2310 520844121 520842382 0.000000e+00 2824
4 TraesCS1B01G172600 chr1B 95.874 1745 64 7 569 2310 671392210 671393949 0.000000e+00 2817
5 TraesCS1B01G172600 chr1B 96.735 245 6 2 2307 2549 442921411 442921655 8.490000e-110 407
6 TraesCS1B01G172600 chr1B 96.327 245 7 2 2307 2549 427481528 427481284 3.950000e-108 401
7 TraesCS1B01G172600 chr1B 96.311 244 6 2 2307 2549 498440626 498440385 5.110000e-107 398
8 TraesCS1B01G172600 chr1B 95.935 246 7 2 2307 2549 130646794 130647039 1.840000e-106 396
9 TraesCS1B01G172600 chr2B 96.677 1986 59 7 569 2549 776161413 776163396 0.000000e+00 3295
10 TraesCS1B01G172600 chr2B 94.957 575 18 10 1 568 344787847 344787277 0.000000e+00 891
11 TraesCS1B01G172600 chr2B 94.921 571 21 8 1 568 515601563 515602128 0.000000e+00 887
12 TraesCS1B01G172600 chr2B 97.541 244 5 1 2307 2549 695138463 695138220 1.410000e-112 416
13 TraesCS1B01G172600 chr5B 95.459 1982 74 6 570 2549 523834976 523836943 0.000000e+00 3147
14 TraesCS1B01G172600 chr5B 96.696 1846 50 10 560 2400 81902658 81904497 0.000000e+00 3061
15 TraesCS1B01G172600 chr5B 97.181 1703 46 2 569 2270 682395996 682394295 0.000000e+00 2878
16 TraesCS1B01G172600 chr5B 96.103 1745 60 6 569 2310 129114118 129115857 0.000000e+00 2839
17 TraesCS1B01G172600 chr5B 95.622 571 20 4 1 568 98487612 98487044 0.000000e+00 911
18 TraesCS1B01G172600 chr5B 95.088 570 19 9 1 568 460007718 460007156 0.000000e+00 889
19 TraesCS1B01G172600 chr6B 95.271 571 22 4 1 568 409318395 409317827 0.000000e+00 900
20 TraesCS1B01G172600 chr6B 96.735 245 6 2 2307 2549 478989504 478989260 8.490000e-110 407
21 TraesCS1B01G172600 chr7B 94.957 575 20 3 1 568 283915594 283916166 0.000000e+00 893
22 TraesCS1B01G172600 chr7B 96.721 244 7 1 2307 2549 27419658 27419415 3.050000e-109 405
23 TraesCS1B01G172600 chr3B 95.096 571 20 7 1 568 202064083 202064648 0.000000e+00 893
24 TraesCS1B01G172600 chr3B 94.783 575 22 4 1 568 480629244 480628671 0.000000e+00 889
25 TraesCS1B01G172600 chr3B 97.551 245 4 2 2307 2549 19703045 19703289 3.920000e-113 418
26 TraesCS1B01G172600 chr3B 97.551 245 4 2 2307 2549 474241371 474241127 3.920000e-113 418
27 TraesCS1B01G172600 chr3B 97.143 245 5 2 2307 2549 673605603 673605359 1.820000e-111 412
28 TraesCS1B01G172600 chr4B 94.792 576 18 7 1 568 184039512 184040083 0.000000e+00 887
29 TraesCS1B01G172600 chr4B 96.721 244 7 1 2307 2549 605196785 605196542 3.050000e-109 405
30 TraesCS1B01G172600 chr4A 97.541 244 5 1 2307 2549 705527448 705527205 1.410000e-112 416
31 TraesCS1B01G172600 chr4A 97.143 245 5 2 2307 2549 610780018 610779774 1.820000e-111 412
32 TraesCS1B01G172600 chr6A 95.528 246 8 2 2307 2549 30120242 30119997 8.550000e-105 390
33 TraesCS1B01G172600 chr6A 90.763 249 15 4 2307 2549 200080010 200080256 2.450000e-85 326
34 TraesCS1B01G172600 chr6D 82.265 468 49 22 2107 2549 312542759 312542301 8.610000e-100 374
35 TraesCS1B01G172600 chr6D 88.797 241 25 2 2310 2549 28979522 28979283 6.900000e-76 294
36 TraesCS1B01G172600 chr2D 94.000 250 8 3 2307 2549 610932261 610932510 3.100000e-99 372
37 TraesCS1B01G172600 chr2D 88.446 251 20 6 2307 2549 636787125 636786876 6.900000e-76 294
38 TraesCS1B01G172600 chrUn 91.304 253 11 5 2307 2549 60560344 60560595 4.060000e-88 335
39 TraesCS1B01G172600 chrUn 90.873 252 14 4 2307 2549 37354148 37353897 1.890000e-86 329
40 TraesCS1B01G172600 chrUn 90.873 252 14 4 2307 2549 287429675 287429424 1.890000e-86 329
41 TraesCS1B01G172600 chrUn 89.558 249 18 5 2307 2549 353552002 353551756 2.460000e-80 309
42 TraesCS1B01G172600 chrUn 88.525 244 26 2 2307 2549 302375622 302375864 6.900000e-76 294
43 TraesCS1B01G172600 chr3D 90.323 248 16 4 2310 2549 108651271 108651024 4.090000e-83 318
44 TraesCS1B01G172600 chr1A 90.361 249 15 5 2307 2549 547458031 547458276 4.090000e-83 318
45 TraesCS1B01G172600 chr1A 89.157 249 19 5 2307 2549 22793338 22793584 1.150000e-78 303
46 TraesCS1B01G172600 chr7D 88.446 251 18 6 2310 2549 487832394 487832144 2.480000e-75 292
47 TraesCS1B01G172600 chr7D 88.095 252 21 4 2307 2549 22899754 22899503 8.920000e-75 291


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G172600 chr1B 307939137 307941685 2548 False 4708 4708 100.000 1 2549 1 chr1B.!!$F2 2548
1 TraesCS1B01G172600 chr1B 616701985 616703966 1981 True 3321 3321 96.927 569 2549 1 chr1B.!!$R4 1980
2 TraesCS1B01G172600 chr1B 561526125 561527869 1744 False 2835 2835 95.998 565 2310 1 chr1B.!!$F4 1745
3 TraesCS1B01G172600 chr1B 520842382 520844121 1739 True 2824 2824 95.936 567 2310 1 chr1B.!!$R3 1743
4 TraesCS1B01G172600 chr1B 671392210 671393949 1739 False 2817 2817 95.874 569 2310 1 chr1B.!!$F5 1741
5 TraesCS1B01G172600 chr2B 776161413 776163396 1983 False 3295 3295 96.677 569 2549 1 chr2B.!!$F2 1980
6 TraesCS1B01G172600 chr2B 344787277 344787847 570 True 891 891 94.957 1 568 1 chr2B.!!$R1 567
7 TraesCS1B01G172600 chr2B 515601563 515602128 565 False 887 887 94.921 1 568 1 chr2B.!!$F1 567
8 TraesCS1B01G172600 chr5B 523834976 523836943 1967 False 3147 3147 95.459 570 2549 1 chr5B.!!$F3 1979
9 TraesCS1B01G172600 chr5B 81902658 81904497 1839 False 3061 3061 96.696 560 2400 1 chr5B.!!$F1 1840
10 TraesCS1B01G172600 chr5B 682394295 682395996 1701 True 2878 2878 97.181 569 2270 1 chr5B.!!$R3 1701
11 TraesCS1B01G172600 chr5B 129114118 129115857 1739 False 2839 2839 96.103 569 2310 1 chr5B.!!$F2 1741
12 TraesCS1B01G172600 chr5B 98487044 98487612 568 True 911 911 95.622 1 568 1 chr5B.!!$R1 567
13 TraesCS1B01G172600 chr5B 460007156 460007718 562 True 889 889 95.088 1 568 1 chr5B.!!$R2 567
14 TraesCS1B01G172600 chr6B 409317827 409318395 568 True 900 900 95.271 1 568 1 chr6B.!!$R1 567
15 TraesCS1B01G172600 chr7B 283915594 283916166 572 False 893 893 94.957 1 568 1 chr7B.!!$F1 567
16 TraesCS1B01G172600 chr3B 202064083 202064648 565 False 893 893 95.096 1 568 1 chr3B.!!$F2 567
17 TraesCS1B01G172600 chr3B 480628671 480629244 573 True 889 889 94.783 1 568 1 chr3B.!!$R2 567
18 TraesCS1B01G172600 chr4B 184039512 184040083 571 False 887 887 94.792 1 568 1 chr4B.!!$F1 567

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
399 433 0.324614 TGGATGCACACCCACTAGTG 59.675 55.0 16.34 16.34 43.65 2.74 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2177 2233 0.968393 AAACACCACAAACCCACGCT 60.968 50.0 0.0 0.0 0.0 5.07 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
82 83 6.773685 TGATGATCATCATTGTTGGAGCATTA 59.226 34.615 30.27 5.80 42.42 1.90
92 100 4.219115 TGTTGGAGCATTACCCAAAAAGA 58.781 39.130 0.00 0.00 43.30 2.52
218 252 3.838317 AGCACCTTGTCCTTCATGTAGTA 59.162 43.478 0.00 0.00 0.00 1.82
264 298 5.238583 AGTAGCACCTTGTTCTTCATGTAC 58.761 41.667 0.00 0.00 0.00 2.90
338 372 9.331282 AGAACTTGGCTTGTATATTTCTATGAC 57.669 33.333 0.00 0.00 0.00 3.06
399 433 0.324614 TGGATGCACACCCACTAGTG 59.675 55.000 16.34 16.34 43.65 2.74
592 628 6.960542 TGGGTTAATTATCCTTTTGCCCTTAA 59.039 34.615 11.51 0.00 34.88 1.85
603 639 4.323569 TTTGCCCTTAATGGTGTCCATA 57.676 40.909 1.53 0.00 44.40 2.74
663 699 2.735772 CCCCTAGTCCATGCGCACT 61.736 63.158 14.90 8.07 0.00 4.40
767 803 4.095185 CGGCCAATTTTATTCAGACCGTTA 59.905 41.667 2.24 0.00 33.64 3.18
938 974 1.741770 CTAGTTGTGGAGGGCACGC 60.742 63.158 0.00 0.00 0.00 5.34
1209 1245 0.246635 CGTGGTCGGGATCTTTGAGT 59.753 55.000 0.00 0.00 0.00 3.41
1213 1249 4.514401 GTGGTCGGGATCTTTGAGTAATT 58.486 43.478 0.00 0.00 0.00 1.40
1755 1795 4.898861 TCCAGAGCCAAACAATTAAGGTTT 59.101 37.500 3.01 3.01 38.92 3.27
2177 2233 2.055299 GGGACTCGAACCCAAGACA 58.945 57.895 18.78 0.00 46.05 3.41
2203 2259 2.036387 GGTTTGTGGTGTTTAGGGCTT 58.964 47.619 0.00 0.00 0.00 4.35
2224 2280 0.464452 GCTGGTAACCGCTAGGACAT 59.536 55.000 0.00 0.00 41.02 3.06
2325 2384 4.757657 ACCGTGAAAATGTATGTTGCACTA 59.242 37.500 0.00 0.00 0.00 2.74
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
218 252 8.798859 ACTTTGAAGCACAATATATGAGACTT 57.201 30.769 0.00 0.00 38.36 3.01
331 365 1.860641 TTGAGGAAGCCCGTCATAGA 58.139 50.000 0.84 0.00 39.16 1.98
338 372 3.200522 GGCATTTGAGGAAGCCCG 58.799 61.111 0.00 0.00 41.25 6.13
399 433 6.385033 AGCTATGAATGCTCAACAAAAGAAC 58.615 36.000 0.00 0.00 35.67 3.01
592 628 3.939740 AACTGAGCATATGGACACCAT 57.060 42.857 4.56 8.35 46.99 3.55
603 639 1.074405 TCTGAGGGCAAAACTGAGCAT 59.926 47.619 0.00 0.00 0.00 3.79
663 699 3.194861 CCAAAGTTCACAGAACGAGTCA 58.805 45.455 4.43 0.00 0.00 3.41
886 922 2.437537 TGCTCTCGCTCTCTCGCT 60.438 61.111 0.00 0.00 36.97 4.93
938 974 2.187946 CAGCTAGCTTCCCACCGG 59.812 66.667 16.46 0.00 0.00 5.28
1209 1245 4.647611 ACACGGAACAGATCAACCAATTA 58.352 39.130 0.00 0.00 0.00 1.40
1213 1249 2.158885 TGAACACGGAACAGATCAACCA 60.159 45.455 0.00 0.00 0.00 3.67
1673 1713 8.791675 GTTTCTGAATTCTTCATTTCTTCTCCT 58.208 33.333 7.05 0.00 39.30 3.69
1796 1837 7.873719 TCACGGTGTATTTGAATTGGATTAT 57.126 32.000 8.17 0.00 0.00 1.28
1981 2034 3.003763 GGGTTCGAGTCCCCAGCT 61.004 66.667 14.49 0.00 40.88 4.24
2177 2233 0.968393 AAACACCACAAACCCACGCT 60.968 50.000 0.00 0.00 0.00 5.07
2224 2280 3.245229 ACCCATGTCAAACTCTTGCCATA 60.245 43.478 0.00 0.00 29.52 2.74
2294 2352 5.705441 ACATACATTTTCACGGTCTCACATT 59.295 36.000 0.00 0.00 0.00 2.71
2312 2370 3.342719 CCACATGGTAGTGCAACATACA 58.657 45.455 0.00 0.00 41.43 2.29


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.