AutoCloner

Multiple sequence alignment - TraesCS1B01G170800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)

BLAST Results

Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

	qseqid	sseqid	percentage.identical	alignment.length	no.mismatch	no.gap.openings	qstart	qend	sstart	send	bitscore
0	TraesCS1B01G170800	chr1B	100.000	2640	0	0	1	2640	302772357	302769718	4876
1	TraesCS1B01G170800	chr7B	98.750	2640	31	1	1	2640	102652613	102655250	4691
2	TraesCS1B01G170800	chr7B	98.859	2454	27	1	1	2454	133432652	133430200	4375
3	TraesCS1B01G170800	chr7B	92.429	700	41	6	1953	2640	235456169	235455470	989
4	TraesCS1B01G170800	chr5B	98.674	2640	35	0	1	2640	351469615	351466976	4682
5	TraesCS1B01G170800	chr5B	97.992	2640	50	2	1	2640	471294932	471292296	4578
6	TraesCS1B01G170800	chr5B	98.248	2455	41	2	1	2454	433002512	433000059	4294
7	TraesCS1B01G170800	chr4B	98.561	2640	35	2	1	2640	649623168	649625804	4662
8	TraesCS1B01G170800	chr4B	98.372	2641	33	3	1	2640	655790979	655793610	4630
9	TraesCS1B01G170800	chr7A	98.297	2642	39	5	1	2640	16005012	16007649	4625
10	TraesCS1B01G170800	chr4A	98.878	2406	26	1	1	2406	735292696	735295100	4292
11	TraesCS1B01G170800	chr2B	91.501	706	47	7	1947	2640	717653971	717654675	959
12	TraesCS1B01G170800	chr6B	87.779	761	43	18	1913	2640	661053590	661054333	845

These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

	query	scaffold	start	end	length	rev.comp	avg.bitscore	max.bitscore	avg.percent.identical	query.start	query.end	num_hsp	groupid	homo_length
0	TraesCS1B01G170800	chr1B	302769718	302772357	2639	True	4876	4876	100.000	1	2640	1	chr1B.!!$R1	2639
1	TraesCS1B01G170800	chr7B	102652613	102655250	2637	False	4691	4691	98.750	1	2640	1	chr7B.!!$F1	2639
2	TraesCS1B01G170800	chr7B	133430200	133432652	2452	True	4375	4375	98.859	1	2454	1	chr7B.!!$R1	2453
3	TraesCS1B01G170800	chr7B	235455470	235456169	699	True	989	989	92.429	1953	2640	1	chr7B.!!$R2	687
4	TraesCS1B01G170800	chr5B	351466976	351469615	2639	True	4682	4682	98.674	1	2640	1	chr5B.!!$R1	2639
5	TraesCS1B01G170800	chr5B	471292296	471294932	2636	True	4578	4578	97.992	1	2640	1	chr5B.!!$R3	2639
6	TraesCS1B01G170800	chr5B	433000059	433002512	2453	True	4294	4294	98.248	1	2454	1	chr5B.!!$R2	2453
7	TraesCS1B01G170800	chr4B	649623168	649625804	2636	False	4662	4662	98.561	1	2640	1	chr4B.!!$F1	2639
8	TraesCS1B01G170800	chr4B	655790979	655793610	2631	False	4630	4630	98.372	1	2640	1	chr4B.!!$F2	2639
9	TraesCS1B01G170800	chr7A	16005012	16007649	2637	False	4625	4625	98.297	1	2640	1	chr7A.!!$F1	2639
10	TraesCS1B01G170800	chr4A	735292696	735295100	2404	False	4292	4292	98.878	1	2406	1	chr4A.!!$F1	2405
11	TraesCS1B01G170800	chr2B	717653971	717654675	704	False	959	959	91.501	1947	2640	1	chr2B.!!$F1	693
12	TraesCS1B01G170800	chr6B	661053590	661054333	743	False	845	845	87.779	1913	2640	1	chr6B.!!$F1	727

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability	Orientation
766	772	0.038159	GGTCGAGCTAGCACAAGTGT	60.038	55.0	18.83	0.0	0.0	3.55	F

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability	Orientation
1936	1942	0.979709	CTGGATCTGGGAGGCAGACA	60.98	60.0	0.0	0.0	0.0	3.41	R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)

Show entries

Search:

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Hairpin	End Stability
718	724	2.231478	GTGCTAGAGGTGCTAGTGTTCA	59.769	50.000	0.00	46.81	3.18
766	772	0.038159	GGTCGAGCTAGCACAAGTGT	60.038	55.000	18.83	0.00	3.55
1053	1059	1.813859	CGCGGACCAAGAGGACATA	59.186	57.895	0.00	38.69	2.29
1059	1065	2.235402	GGACCAAGAGGACATACCGAAA	59.765	50.000	0.00	44.74	3.46
1220	1226	3.054508	TGTCCCAACTATGCACATGATCA	60.055	43.478	0.00	0.00	2.92
1823	1829	8.851541	ATGCTTTGTTCATATTTTTGGTTGAT	57.148	26.923	0.00	0.00	2.57
1891	1897	6.816140	TGCTAAGCAAAAACTTAAACAAGCTT	59.184	30.769	0.00	42.87	3.74
1905	1911	3.663025	ACAAGCTTTGTGCAAAAACACT	58.337	36.364	0.00	43.48	3.55
1936	1942	4.722700	GACGCCAGGGTGCATGGT	62.723	66.667	6.68	40.17	3.55
2128	2134	2.348998	GCAGGTGACCAGACAGGG	59.651	66.667	3.63	43.89	4.45

Showing 1 to 10 of 10 entries

Previous1Next

Show entries

Search:

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Hairpin	End Stability
718	724	1.577736	AGCACTTGTGCTCCCTCTAT	58.422	50.000	20.95	42.12	1.98
766	772	0.541063	TGCTCGACCACCACCTCTAA	60.541	55.000	0.00	0.00	2.10
1059	1065	2.113139	CTGGCCTCCAACCACGTT	59.887	61.111	3.32	30.80	3.99
1220	1226	0.036765	TGCGTTAGTTGGCCTTCGAT	60.037	50.000	3.32	0.00	3.59
1402	1408	1.017177	TCCGTAACCAATCTGCACGC	61.017	55.000	0.00	0.00	5.34
1566	1572	2.202878	GTGCATCGCGAGCCCTTA	60.203	61.111	16.66	0.00	2.69
1882	1888	4.514816	AGTGTTTTTGCACAAAGCTTGTTT	59.485	33.333	0.00	43.23	2.83
1891	1897	1.410882	GGGCCTAGTGTTTTTGCACAA	59.589	47.619	0.84	41.52	3.33
1905	1911	3.000819	CGTCTGGGTGTGGGCCTA	61.001	66.667	4.53	0.00	3.93
1936	1942	0.979709	CTGGATCTGGGAGGCAGACA	60.980	60.000	0.00	0.00	3.41
2128	2134	1.016130	CCATCAGACACACCAGACGC	61.016	60.000	0.00	0.00	5.19
2476	2523	3.131933	ACCGATTTGTGAGAGATCTGAGG	59.868	47.826	0.00	0.00	3.86
2477	2524	4.358851	GACCGATTTGTGAGAGATCTGAG	58.641	47.826	0.00	0.00	3.35
2598	2645	3.118149	ACCACGAGGAAAACAAACTAGGT	60.118	43.478	5.68	38.69	3.08

Showing 1 to 14 of 14 entries

Previous1Next

Based at the University of Bristol with support from BBSRC.

AutoCloner maintained by Alex Coulton.