Multiple sequence alignment - TraesCS1B01G166400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G166400 chr1B 100.000 2467 0 0 1 2467 292347817 292350283 0.000000e+00 4556
1 TraesCS1B01G166400 chr1B 98.695 2298 29 1 1 2298 292422143 292424439 0.000000e+00 4076
2 TraesCS1B01G166400 chr1B 80.159 252 30 12 2124 2371 53985360 53985595 1.170000e-38 171
3 TraesCS1B01G166400 chr1B 89.051 137 11 2 1 133 551150195 551150331 1.520000e-37 167
4 TraesCS1B01G166400 chr1B 91.753 97 6 1 2370 2466 53985639 53985733 1.540000e-27 134
5 TraesCS1B01G166400 chr4B 93.490 2212 122 8 1 2210 161489392 161487201 0.000000e+00 3267
6 TraesCS1B01G166400 chr4B 91.011 178 5 3 2195 2372 654695074 654694908 1.910000e-56 230
7 TraesCS1B01G166400 chr4B 91.753 97 5 1 2370 2466 161486968 161486875 5.540000e-27 132
8 TraesCS1B01G166400 chr4B 90.722 97 7 1 2370 2466 654694864 654694770 7.160000e-26 128
9 TraesCS1B01G166400 chr4B 90.722 97 7 1 2370 2466 654802292 654802198 7.160000e-26 128
10 TraesCS1B01G166400 chrUn 94.020 1321 71 4 895 2214 49575978 49574665 0.000000e+00 1995
11 TraesCS1B01G166400 chrUn 94.911 845 40 3 1 844 49576817 49575975 0.000000e+00 1319
12 TraesCS1B01G166400 chrUn 83.465 254 31 8 2121 2372 37757333 37757089 2.470000e-55 226
13 TraesCS1B01G166400 chrUn 83.465 254 31 8 2121 2372 322370724 322370968 2.470000e-55 226
14 TraesCS1B01G166400 chrUn 91.489 94 6 1 2373 2466 49574443 49574352 7.160000e-26 128
15 TraesCS1B01G166400 chr5D 94.820 1197 44 5 1 1194 393605260 393604079 0.000000e+00 1851
16 TraesCS1B01G166400 chr5D 89.051 137 11 2 1 133 486415055 486415191 1.520000e-37 167
17 TraesCS1B01G166400 chr5A 95.047 747 33 3 1464 2210 503685103 503684361 0.000000e+00 1171
18 TraesCS1B01G166400 chr5A 93.194 191 12 1 1 190 503685700 503685510 1.870000e-71 279
19 TraesCS1B01G166400 chr5A 97.727 132 3 0 1325 1456 503685513 503685382 6.860000e-56 228
20 TraesCS1B01G166400 chr2A 94.482 598 31 1 1613 2210 196078951 196078356 0.000000e+00 920
21 TraesCS1B01G166400 chr2A 93.720 414 16 4 1450 1853 560575104 560575517 1.620000e-171 612
22 TraesCS1B01G166400 chr4A 94.147 598 33 1 1613 2210 586019515 586018920 0.000000e+00 909
23 TraesCS1B01G166400 chr4A 95.212 543 24 2 1 542 99778220 99777679 0.000000e+00 857
24 TraesCS1B01G166400 chr4A 90.446 471 42 3 614 1083 730355523 730355991 3.490000e-173 617
25 TraesCS1B01G166400 chr4A 92.021 188 14 1 1080 1267 730356088 730356274 1.880000e-66 263
26 TraesCS1B01G166400 chr4A 78.967 271 28 17 2219 2466 586018834 586018570 9.130000e-35 158
27 TraesCS1B01G166400 chr2D 93.688 602 31 3 1613 2210 651121844 651121246 0.000000e+00 894
28 TraesCS1B01G166400 chr2D 93.377 604 31 4 1613 2210 430736025 430736625 0.000000e+00 885
29 TraesCS1B01G166400 chr6A 93.478 598 37 1 1613 2210 257018307 257017712 0.000000e+00 887
30 TraesCS1B01G166400 chr6A 91.667 624 40 6 1080 1694 92340219 92340839 0.000000e+00 854
31 TraesCS1B01G166400 chr6A 90.894 604 40 8 481 1083 92339533 92340122 0.000000e+00 797
32 TraesCS1B01G166400 chr6A 94.085 355 20 1 137 490 92300481 92300835 2.790000e-149 538
33 TraesCS1B01G166400 chr3A 95.131 534 25 1 719 1252 555513064 555512532 0.000000e+00 841
34 TraesCS1B01G166400 chr3A 90.602 532 44 4 555 1083 725009775 725009247 0.000000e+00 701
35 TraesCS1B01G166400 chr3A 95.516 223 10 0 1432 1654 555512532 555512310 8.390000e-95 357
36 TraesCS1B01G166400 chr7B 91.095 539 38 5 554 1083 383729231 383729768 0.000000e+00 721
37 TraesCS1B01G166400 chr7B 92.800 375 25 2 1080 1454 383729864 383730236 2.160000e-150 542
38 TraesCS1B01G166400 chr7D 89.591 538 46 6 554 1083 388692916 388693451 0.000000e+00 675
39 TraesCS1B01G166400 chr7D 93.333 375 23 2 1080 1454 388693547 388693919 9.970000e-154 553
40 TraesCS1B01G166400 chr7A 93.333 375 23 2 1080 1454 438851430 438851802 9.970000e-154 553
41 TraesCS1B01G166400 chr7A 84.615 195 11 6 2195 2370 581688943 581688749 2.520000e-40 176
42 TraesCS1B01G166400 chr7A 85.795 176 12 4 2197 2372 348727863 348728025 9.070000e-40 174
43 TraesCS1B01G166400 chr5B 88.434 415 29 6 1457 1860 664213612 664213206 1.330000e-132 483
44 TraesCS1B01G166400 chr5B 86.885 122 3 2 2252 2373 488988550 488988658 9.260000e-25 124
45 TraesCS1B01G166400 chr1A 88.067 419 35 6 1457 1860 276114698 276114280 1.330000e-132 483
46 TraesCS1B01G166400 chr1A 91.753 97 5 2 2370 2466 253307586 253307679 5.540000e-27 132
47 TraesCS1B01G166400 chr6B 90.449 178 14 2 2197 2372 665375667 665375843 5.310000e-57 231
48 TraesCS1B01G166400 chr6B 82.677 254 28 8 2121 2372 653198090 653197851 6.910000e-51 211
49 TraesCS1B01G166400 chr3D 76.882 372 45 23 2121 2467 41147698 41148053 3.260000e-39 172
50 TraesCS1B01G166400 chr2B 91.837 98 8 0 2370 2467 13435033 13434936 1.190000e-28 137


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G166400 chr1B 292347817 292350283 2466 False 4556.000000 4556 100.000000 1 2467 1 chr1B.!!$F1 2466
1 TraesCS1B01G166400 chr1B 292422143 292424439 2296 False 4076.000000 4076 98.695000 1 2298 1 chr1B.!!$F2 2297
2 TraesCS1B01G166400 chr4B 161486875 161489392 2517 True 1699.500000 3267 92.621500 1 2466 2 chr4B.!!$R2 2465
3 TraesCS1B01G166400 chrUn 49574352 49576817 2465 True 1147.333333 1995 93.473333 1 2466 3 chrUn.!!$R2 2465
4 TraesCS1B01G166400 chr5D 393604079 393605260 1181 True 1851.000000 1851 94.820000 1 1194 1 chr5D.!!$R1 1193
5 TraesCS1B01G166400 chr5A 503684361 503685700 1339 True 559.333333 1171 95.322667 1 2210 3 chr5A.!!$R1 2209
6 TraesCS1B01G166400 chr2A 196078356 196078951 595 True 920.000000 920 94.482000 1613 2210 1 chr2A.!!$R1 597
7 TraesCS1B01G166400 chr4A 99777679 99778220 541 True 857.000000 857 95.212000 1 542 1 chr4A.!!$R1 541
8 TraesCS1B01G166400 chr4A 586018570 586019515 945 True 533.500000 909 86.557000 1613 2466 2 chr4A.!!$R2 853
9 TraesCS1B01G166400 chr4A 730355523 730356274 751 False 440.000000 617 91.233500 614 1267 2 chr4A.!!$F1 653
10 TraesCS1B01G166400 chr2D 651121246 651121844 598 True 894.000000 894 93.688000 1613 2210 1 chr2D.!!$R1 597
11 TraesCS1B01G166400 chr2D 430736025 430736625 600 False 885.000000 885 93.377000 1613 2210 1 chr2D.!!$F1 597
12 TraesCS1B01G166400 chr6A 257017712 257018307 595 True 887.000000 887 93.478000 1613 2210 1 chr6A.!!$R1 597
13 TraesCS1B01G166400 chr6A 92339533 92340839 1306 False 825.500000 854 91.280500 481 1694 2 chr6A.!!$F2 1213
14 TraesCS1B01G166400 chr3A 725009247 725009775 528 True 701.000000 701 90.602000 555 1083 1 chr3A.!!$R1 528
15 TraesCS1B01G166400 chr3A 555512310 555513064 754 True 599.000000 841 95.323500 719 1654 2 chr3A.!!$R2 935
16 TraesCS1B01G166400 chr7B 383729231 383730236 1005 False 631.500000 721 91.947500 554 1454 2 chr7B.!!$F1 900
17 TraesCS1B01G166400 chr7D 388692916 388693919 1003 False 614.000000 675 91.462000 554 1454 2 chr7D.!!$F1 900

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
669 678 2.092753 TGCTCATTCTTCCTGATGGACC 60.093 50.0 0.0 0.0 43.06 4.46 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2310 2799 2.714387 CACATGCACACACGCACA 59.286 55.556 0.0 0.0 46.56 4.57 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
103 105 6.039382 AGGCAGTTTTCTTCGATAGTTTTGTT 59.961 34.615 0.00 0.00 37.40 2.83
640 649 7.244898 CACTATGTGTGTCTCACTAGTAGTTC 58.755 42.308 0.00 0.00 46.27 3.01
669 678 2.092753 TGCTCATTCTTCCTGATGGACC 60.093 50.000 0.00 0.00 43.06 4.46
747 765 5.048921 ACTTGCAGACTTGTGAATCAATCAG 60.049 40.000 0.00 0.00 39.19 2.90
860 878 6.745794 AATTGAAAAGGATCCAAACAAGGA 57.254 33.333 15.82 0.00 43.01 3.36
1260 1380 5.393962 CGGTGGAAAGCAAAGATTTCTAAG 58.606 41.667 7.54 0.00 37.94 2.18
1630 2030 2.806244 CACACCAAGTGCTGTTACTACC 59.194 50.000 0.00 0.00 42.15 3.18
2061 2467 6.380274 TCCTAGTAGTGGTCTTGGTTCATTAG 59.620 42.308 0.00 0.00 0.00 1.73
2263 2752 2.301902 GACGCCGACGACATAGACGT 62.302 60.000 0.00 0.00 46.58 4.34
2293 2782 0.239613 TTGTGTGTGTGTGTGTGTGC 59.760 50.000 0.00 0.00 0.00 4.57
2431 2966 4.078537 TGTTACTAGTAGCGTGGGTGTAA 58.921 43.478 11.55 0.00 0.00 2.41
2439 2974 3.688694 AGCGTGGGTGTAACATAGAAA 57.311 42.857 0.00 0.00 39.98 2.52
2442 2977 2.669434 CGTGGGTGTAACATAGAAACGG 59.331 50.000 0.00 0.00 39.98 4.44
2448 2983 5.336690 GGGTGTAACATAGAAACGGTACTGA 60.337 44.000 9.17 0.00 39.98 3.41
2466 3001 9.282569 CGGTACTGATATTCCTTTACTAGTAGT 57.717 37.037 8.14 8.14 0.00 2.73
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
22 23 5.467735 TGATGCATCAATGTAGATGTAGCAC 59.532 40.000 26.87 0.00 46.73 4.40
103 105 2.284754 TGACTGGTAGCAATGGCAAA 57.715 45.000 0.00 0.00 44.61 3.68
640 649 3.937706 CAGGAAGAATGAGCACCTGTTAG 59.062 47.826 0.00 0.00 41.91 2.34
747 765 6.064846 ACGATCAAGATTGTAAATGCATCC 57.935 37.500 0.00 0.00 33.79 3.51
860 878 2.555757 GCTGCTCAGAACAATGGAACTT 59.444 45.455 0.29 0.00 0.00 2.66
1396 1516 0.474466 AGGCTGCATATAGGCCCAGA 60.474 55.000 10.11 0.00 46.31 3.86
1897 2303 4.717280 AGTTCCTAACAGACCAATCCTAGG 59.283 45.833 0.82 0.82 0.00 3.02
2003 2409 7.512992 AGAAGCTGGAGCATTAGTACAATATT 58.487 34.615 0.65 0.00 45.16 1.28
2061 2467 6.434340 AGGAACTCACAAATCCTGGAATTAAC 59.566 38.462 0.00 0.00 41.96 2.01
2263 2752 4.155644 CACACACACACAATATATGCCACA 59.844 41.667 0.00 0.00 0.00 4.17
2310 2799 2.714387 CACATGCACACACGCACA 59.286 55.556 0.00 0.00 46.56 4.57
2323 2812 7.494298 TGATGTAGATAATTAACACACGCACAT 59.506 33.333 0.00 0.00 0.00 3.21
2431 2966 7.598759 AGGAATATCAGTACCGTTTCTATGT 57.401 36.000 0.00 0.00 0.00 2.29
2439 2974 9.282569 CTACTAGTAAAGGAATATCAGTACCGT 57.717 37.037 3.76 0.00 0.00 4.83


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.