Multiple sequence alignment - TraesCS1B01G160600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G160600 chr1B 100.000 2351 0 0 1 2351 275601281 275603631 0.000000e+00 4342
1 TraesCS1B01G160600 chr1B 96.269 1474 47 5 883 2351 275469179 275470649 0.000000e+00 2410
2 TraesCS1B01G160600 chr1B 96.065 1474 40 7 883 2351 275371907 275373367 0.000000e+00 2385
3 TraesCS1B01G160600 chr1B 91.892 1295 92 8 881 2167 275676699 275677988 0.000000e+00 1797
4 TraesCS1B01G160600 chr1B 97.404 886 22 1 1 885 275593297 275594182 0.000000e+00 1507
5 TraesCS1B01G160600 chr1B 90.155 386 32 3 1783 2167 278630497 278630117 4.510000e-137 497
6 TraesCS1B01G160600 chr1A 93.468 1087 65 3 1084 2167 246090676 246089593 0.000000e+00 1609
7 TraesCS1B01G160600 chr1A 91.401 1128 66 23 1040 2165 245835348 245834250 0.000000e+00 1517
8 TraesCS1B01G160600 chr1A 96.183 131 5 0 883 1013 245959935 245959805 5.090000e-52 215
9 TraesCS1B01G160600 chr1A 94.656 131 7 0 883 1013 246124473 246124343 1.100000e-48 204
10 TraesCS1B01G160600 chr7B 94.607 890 39 8 1 885 349536521 349535636 0.000000e+00 1369
11 TraesCS1B01G160600 chr7B 94.388 891 41 8 1 886 267486508 267487394 0.000000e+00 1360
12 TraesCS1B01G160600 chr7B 94.157 890 43 8 1 885 267471933 267472818 0.000000e+00 1347
13 TraesCS1B01G160600 chr7B 94.052 891 42 10 1 884 296655891 296656777 0.000000e+00 1341
14 TraesCS1B01G160600 chr7B 93.933 890 45 8 1 885 296647964 296648849 0.000000e+00 1336
15 TraesCS1B01G160600 chr6B 94.743 875 41 4 1 872 156864871 156865743 0.000000e+00 1356
16 TraesCS1B01G160600 chr3B 94.138 887 48 4 1 885 141588094 141588978 0.000000e+00 1347
17 TraesCS1B01G160600 chr3B 93.729 893 49 7 1 890 123690615 123689727 0.000000e+00 1332
18 TraesCS1B01G160600 chr3B 95.187 187 8 1 2166 2351 312181893 312182079 6.350000e-76 294
19 TraesCS1B01G160600 chr4D 91.005 378 25 6 1792 2167 286415805 286415435 3.490000e-138 501
20 TraesCS1B01G160600 chr4D 87.150 428 47 5 1359 1783 296670123 296669701 1.630000e-131 479
21 TraesCS1B01G160600 chr4D 96.237 186 6 1 2167 2351 130133895 130134080 1.060000e-78 303
22 TraesCS1B01G160600 chr4D 87.678 211 24 2 1784 1993 102119712 102119503 6.490000e-61 244
23 TraesCS1B01G160600 chr3A 90.181 387 35 3 1784 2167 80004772 80004386 3.490000e-138 501
24 TraesCS1B01G160600 chr4B 89.896 386 36 3 1784 2167 54123076 54123460 5.840000e-136 494
25 TraesCS1B01G160600 chr2B 87.119 427 51 3 1361 1783 195930232 195930658 4.540000e-132 481
26 TraesCS1B01G160600 chr7D 86.374 433 48 7 1360 1786 527766149 527766576 1.650000e-126 462
27 TraesCS1B01G160600 chr7D 95.722 187 6 2 2167 2351 327852835 327853021 1.370000e-77 300
28 TraesCS1B01G160600 chr3D 86.150 426 54 3 1360 1783 534685139 534684717 2.750000e-124 455
29 TraesCS1B01G160600 chr3D 95.187 187 8 1 2166 2351 146790650 146790836 6.350000e-76 294
30 TraesCS1B01G160600 chr3D 87.712 236 25 4 1756 1990 503868287 503868055 2.980000e-69 272
31 TraesCS1B01G160600 chr3D 86.638 232 27 4 1763 1993 142559710 142559482 1.080000e-63 254
32 TraesCS1B01G160600 chr7A 81.618 408 69 3 1603 2004 465858527 465858934 1.350000e-87 333
33 TraesCS1B01G160600 chr6D 95.699 186 7 1 2167 2351 194038361 194038546 4.910000e-77 298
34 TraesCS1B01G160600 chr6D 93.035 201 11 3 2152 2351 286986306 286986504 8.220000e-75 291
35 TraesCS1B01G160600 chr2D 95.699 186 7 1 2167 2351 240964539 240964724 4.910000e-77 298
36 TraesCS1B01G160600 chr2D 95.699 186 7 1 2167 2351 419536655 419536840 4.910000e-77 298


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G160600 chr1B 275601281 275603631 2350 False 4342 4342 100.000 1 2351 1 chr1B.!!$F4 2350
1 TraesCS1B01G160600 chr1B 275469179 275470649 1470 False 2410 2410 96.269 883 2351 1 chr1B.!!$F2 1468
2 TraesCS1B01G160600 chr1B 275371907 275373367 1460 False 2385 2385 96.065 883 2351 1 chr1B.!!$F1 1468
3 TraesCS1B01G160600 chr1B 275676699 275677988 1289 False 1797 1797 91.892 881 2167 1 chr1B.!!$F5 1286
4 TraesCS1B01G160600 chr1B 275593297 275594182 885 False 1507 1507 97.404 1 885 1 chr1B.!!$F3 884
5 TraesCS1B01G160600 chr1A 246089593 246090676 1083 True 1609 1609 93.468 1084 2167 1 chr1A.!!$R3 1083
6 TraesCS1B01G160600 chr1A 245834250 245835348 1098 True 1517 1517 91.401 1040 2165 1 chr1A.!!$R1 1125
7 TraesCS1B01G160600 chr7B 349535636 349536521 885 True 1369 1369 94.607 1 885 1 chr7B.!!$R1 884
8 TraesCS1B01G160600 chr7B 267486508 267487394 886 False 1360 1360 94.388 1 886 1 chr7B.!!$F2 885
9 TraesCS1B01G160600 chr7B 267471933 267472818 885 False 1347 1347 94.157 1 885 1 chr7B.!!$F1 884
10 TraesCS1B01G160600 chr7B 296655891 296656777 886 False 1341 1341 94.052 1 884 1 chr7B.!!$F4 883
11 TraesCS1B01G160600 chr7B 296647964 296648849 885 False 1336 1336 93.933 1 885 1 chr7B.!!$F3 884
12 TraesCS1B01G160600 chr6B 156864871 156865743 872 False 1356 1356 94.743 1 872 1 chr6B.!!$F1 871
13 TraesCS1B01G160600 chr3B 141588094 141588978 884 False 1347 1347 94.138 1 885 1 chr3B.!!$F1 884
14 TraesCS1B01G160600 chr3B 123689727 123690615 888 True 1332 1332 93.729 1 890 1 chr3B.!!$R1 889

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
564 567 2.814805 AGTACTCATTGGCTTGCCAT 57.185 45.0 15.58 2.55 0.0 4.4 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1472 1481 1.268539 CCCGCCATCGCAAATAGTTTC 60.269 52.381 0.0 0.0 34.03 2.78 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
44 45 4.001652 TGTTACGATCTCGAGTGAGTCTT 58.998 43.478 13.13 3.67 43.09 3.01
564 567 2.814805 AGTACTCATTGGCTTGCCAT 57.185 45.000 15.58 2.55 0.00 4.40
901 905 5.513094 CCCACAGAACAATTCTCCAACTAGA 60.513 44.000 0.00 0.00 38.11 2.43
906 910 7.873505 ACAGAACAATTCTCCAACTAGAAGTAC 59.126 37.037 0.00 0.00 38.81 2.73
935 939 6.320418 CAGTAAAAGGGTGAAAGTTACCAAGT 59.680 38.462 0.00 0.00 40.03 3.16
1171 1179 5.308497 TGGATACTAGGTGTGAAAGGTTTCA 59.692 40.000 0.87 0.87 40.54 2.69
1259 1267 3.569277 ACTGTACTTGATGCATGCAACAA 59.431 39.130 32.89 32.89 36.59 2.83
1294 1302 8.504811 TGTTAATATTCTGGATGGTGGATCTA 57.495 34.615 0.00 0.00 0.00 1.98
1767 1778 7.390718 AGACAACAGAAACAGTTCAACTTAACT 59.609 33.333 0.00 0.00 40.33 2.24
1864 1875 2.235402 CCCAACGAGGAGCTAAAGGTAA 59.765 50.000 0.00 0.00 41.22 2.85
2084 2098 9.046296 GTAGAGAGATTTTTGTCACAAGAAAGA 57.954 33.333 0.00 0.00 0.00 2.52
2102 2116 6.731467 AGAAAGATATTTGTCCCTAGGCAAA 58.269 36.000 14.59 14.59 38.68 3.68
2200 2215 5.129485 TGGAACCTAGATGGAGATCTTTCAC 59.871 44.000 0.00 0.00 39.76 3.18
2219 2234 1.923148 ACGAATTGGAGGGGAAATCCT 59.077 47.619 0.00 0.00 40.43 3.24
2333 2348 3.350833 AGAGGTCACAATGATTCAAGGC 58.649 45.455 0.00 0.00 0.00 4.35
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
44 45 7.362920 CCATATCCTCACGATGTACATCATACA 60.363 40.741 30.15 13.26 37.69 2.29
564 567 6.351711 CCATGCCTGGTCAATTAAATAACCAA 60.352 38.462 0.00 0.00 41.07 3.67
797 800 2.093500 TGCTCACTGAACACACAGAAGT 60.093 45.455 0.00 0.00 40.63 3.01
873 876 0.482446 AGAATTGTTCTGTGGGGGCA 59.518 50.000 0.00 0.00 38.91 5.36
875 878 1.075374 TGGAGAATTGTTCTGTGGGGG 59.925 52.381 0.00 0.00 40.87 5.40
901 905 5.043737 TCACCCTTTTACTGCTTGTACTT 57.956 39.130 0.00 0.00 0.00 2.24
906 910 4.918810 ACTTTCACCCTTTTACTGCTTG 57.081 40.909 0.00 0.00 0.00 4.01
935 939 7.819415 CGCCTATATCTCATCATTTCCACTTTA 59.181 37.037 0.00 0.00 0.00 1.85
1044 1048 3.317711 CCAATACCTCACAAACTGCACAA 59.682 43.478 0.00 0.00 0.00 3.33
1171 1179 3.678056 TTCGTCACTACTCCTTGCATT 57.322 42.857 0.00 0.00 0.00 3.56
1177 1185 3.256136 CCACTTCTTTCGTCACTACTCCT 59.744 47.826 0.00 0.00 0.00 3.69
1178 1186 3.255149 TCCACTTCTTTCGTCACTACTCC 59.745 47.826 0.00 0.00 0.00 3.85
1294 1302 3.542604 AGGTTCCCCTCCAAGAAATACT 58.457 45.455 0.00 0.00 35.62 2.12
1472 1481 1.268539 CCCGCCATCGCAAATAGTTTC 60.269 52.381 0.00 0.00 34.03 2.78
1767 1778 6.609616 TGGGTTATCAGTATCACACACATCTA 59.390 38.462 0.00 0.00 0.00 1.98
2084 2098 4.497291 TCGTTTGCCTAGGGACAAATAT 57.503 40.909 11.72 0.00 38.01 1.28
2200 2215 2.576615 GAGGATTTCCCCTCCAATTCG 58.423 52.381 0.00 0.00 45.44 3.34
2219 2234 5.416083 TCTTCGTGTTCTTCTTGTTCTTGA 58.584 37.500 0.00 0.00 0.00 3.02


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.