Multiple sequence alignment - TraesCS1B01G160200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G160200 chr1B 100.000 2348 0 0 1 2348 275371025 275373372 0.000000e+00 4337
1 TraesCS1B01G160200 chr1B 97.625 2358 46 2 1 2348 275468297 275470654 0.000000e+00 4036
2 TraesCS1B01G160200 chr1B 91.505 2107 162 10 69 2167 275675891 275677988 0.000000e+00 2883
3 TraesCS1B01G160200 chr1B 96.078 1479 40 7 883 2348 275602163 275603636 0.000000e+00 2394
4 TraesCS1B01G160200 chr1B 95.045 888 42 2 1 888 275588729 275589614 0.000000e+00 1395
5 TraesCS1B01G160200 chr1A 93.945 1090 61 3 1079 2167 246090678 246089593 0.000000e+00 1642
6 TraesCS1B01G160200 chr1A 94.074 945 55 1 69 1013 246125286 246124343 0.000000e+00 1434
7 TraesCS1B01G160200 chr1A 94.768 669 33 2 1498 2165 245834917 245834250 0.000000e+00 1040
8 TraesCS1B01G160200 chr1A 94.636 522 28 0 492 1013 245960326 245959805 0.000000e+00 809
9 TraesCS1B01G160200 chr1A 94.357 443 22 2 1037 1479 245835348 245834909 0.000000e+00 676
10 TraesCS1B01G160200 chr1A 86.449 428 54 2 1357 1783 330772930 330773354 1.270000e-127 466
11 TraesCS1B01G160200 chr4D 89.019 428 42 3 1356 1783 296670123 296669701 2.070000e-145 525
12 TraesCS1B01G160200 chr4D 90.237 379 26 7 1792 2167 286415805 286415435 3.510000e-133 484
13 TraesCS1B01G160200 chr4D 96.859 191 6 0 2158 2348 70324811 70324621 1.050000e-83 320
14 TraesCS1B01G160200 chr4D 96.154 182 7 0 2167 2348 323223454 323223635 4.910000e-77 298
15 TraesCS1B01G160200 chr4D 97.143 70 0 2 1 68 56938191 56938122 1.470000e-22 117
16 TraesCS1B01G160200 chr4D 95.833 72 2 1 1 71 101604422 101604493 5.300000e-22 115
17 TraesCS1B01G160200 chr4D 95.714 70 2 1 1 69 48728957 48728888 6.860000e-21 111
18 TraesCS1B01G160200 chr4D 94.521 73 2 2 1 72 69735323 69735394 6.860000e-21 111
19 TraesCS1B01G160200 chr4D 94.521 73 2 2 1 71 106420041 106419969 6.860000e-21 111
20 TraesCS1B01G160200 chr4D 90.244 82 6 2 1 80 128001625 128001706 3.190000e-19 106
21 TraesCS1B01G160200 chr3A 90.181 387 35 3 1784 2167 80004772 80004386 3.480000e-138 501
22 TraesCS1B01G160200 chr2D 89.664 387 36 3 1784 2167 355905981 355906366 7.540000e-135 490
23 TraesCS1B01G160200 chr2D 91.566 83 4 3 1 81 53643474 53643555 6.860000e-21 111
24 TraesCS1B01G160200 chr2D 89.888 89 5 3 1 88 580186876 580186961 6.860000e-21 111
25 TraesCS1B01G160200 chr4B 89.378 386 38 3 1784 2167 54123076 54123460 1.260000e-132 483
26 TraesCS1B01G160200 chr3D 86.682 428 52 3 1357 1783 431537712 431537289 9.820000e-129 470
27 TraesCS1B01G160200 chr3D 86.864 236 27 4 1756 1990 503868287 503868055 6.440000e-66 261
28 TraesCS1B01G160200 chr3D 81.275 251 31 6 69 317 21817723 21817487 3.080000e-44 189
29 TraesCS1B01G160200 chr3D 97.101 69 1 1 1 68 209347380 209347448 5.300000e-22 115
30 TraesCS1B01G160200 chr3D 91.566 83 5 2 1 81 378988667 378988749 1.910000e-21 113
31 TraesCS1B01G160200 chr3D 90.476 84 5 3 1 81 416477736 416477819 8.870000e-20 108
32 TraesCS1B01G160200 chr1D 86.417 427 55 1 1357 1783 257020959 257021382 4.570000e-127 464
33 TraesCS1B01G160200 chr1D 95.604 182 8 0 2167 2348 201027330 201027511 2.280000e-75 292
34 TraesCS1B01G160200 chr1D 95.890 73 2 1 1 72 355335869 355335797 1.470000e-22 117
35 TraesCS1B01G160200 chr1D 95.833 72 1 2 1 70 352478146 352478217 5.300000e-22 115
36 TraesCS1B01G160200 chr1D 95.714 70 2 1 1 69 269523870 269523801 6.860000e-21 111
37 TraesCS1B01G160200 chr1D 97.015 67 1 1 3 68 340978247 340978313 6.860000e-21 111
38 TraesCS1B01G160200 chr1D 95.652 69 2 1 1 68 25926057 25926125 2.470000e-20 110
39 TraesCS1B01G160200 chr1D 95.652 69 1 2 1 68 41514467 41514534 2.470000e-20 110
40 TraesCS1B01G160200 chr1D 94.444 72 3 1 1 71 64003186 64003115 2.470000e-20 110
41 TraesCS1B01G160200 chr1D 95.652 69 2 1 1 68 80946274 80946342 2.470000e-20 110
42 TraesCS1B01G160200 chr1D 94.444 72 3 1 1 71 211967715 211967644 2.470000e-20 110
43 TraesCS1B01G160200 chr1D 91.250 80 6 1 1 79 379234059 379233980 8.870000e-20 108
44 TraesCS1B01G160200 chr1D 91.026 78 5 2 1 77 56387213 56387137 1.150000e-18 104
45 TraesCS1B01G160200 chr7A 81.127 408 71 3 1603 2004 465858527 465858934 2.910000e-84 322
46 TraesCS1B01G160200 chr7A 92.405 79 4 2 3 80 394136214 394136137 6.860000e-21 111
47 TraesCS1B01G160200 chr5A 81.490 416 55 18 1763 2167 442779466 442779062 2.910000e-84 322
48 TraesCS1B01G160200 chr5A 93.750 80 3 2 1 78 17873677 17873598 4.100000e-23 119
49 TraesCS1B01G160200 chr7D 96.154 182 7 0 2167 2348 528963335 528963516 4.910000e-77 298
50 TraesCS1B01G160200 chr7D 97.143 70 1 1 1 69 236614799 236614868 1.470000e-22 117
51 TraesCS1B01G160200 chr7D 95.833 72 2 1 1 71 537199179 537199108 5.300000e-22 115
52 TraesCS1B01G160200 chr7D 91.358 81 6 1 1 80 628548448 628548368 2.470000e-20 110
53 TraesCS1B01G160200 chr6D 96.154 182 7 0 2167 2348 361048214 361048033 4.910000e-77 298
54 TraesCS1B01G160200 chr6D 94.681 188 10 0 2161 2348 192098277 192098464 2.280000e-75 292
55 TraesCS1B01G160200 chr6D 95.604 182 8 0 2167 2348 194044379 194044560 2.280000e-75 292
56 TraesCS1B01G160200 chr6D 95.135 185 9 0 2164 2348 211698125 211698309 2.280000e-75 292
57 TraesCS1B01G160200 chr6D 84.774 243 24 9 1755 1994 217431538 217431770 5.050000e-57 231
58 TraesCS1B01G160200 chr5D 94.681 188 9 1 2161 2348 389642700 389642514 8.210000e-75 291
59 TraesCS1B01G160200 chr5D 97.143 70 1 1 1 69 350306756 350306825 1.470000e-22 117
60 TraesCS1B01G160200 chr5D 97.101 69 1 1 1 68 315747733 315747801 5.300000e-22 115
61 TraesCS1B01G160200 chrUn 79.870 308 58 4 1047 1351 474550410 474550716 3.040000e-54 222
62 TraesCS1B01G160200 chr7B 79.866 298 56 4 1047 1341 120467256 120467552 5.080000e-52 215
63 TraesCS1B01G160200 chr2B 78.218 303 62 4 1047 1347 788496855 788497155 8.560000e-45 191
64 TraesCS1B01G160200 chr6A 74.242 462 103 11 891 1347 454688137 454688587 1.850000e-41 180
65 TraesCS1B01G160200 chr3B 79.500 200 25 10 71 268 38052470 38052285 6.810000e-26 128
66 TraesCS1B01G160200 chr3B 97.183 71 1 1 1 70 141332387 141332317 4.100000e-23 119
67 TraesCS1B01G160200 chr5B 91.463 82 5 2 1 80 330240126 330240045 6.860000e-21 111


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G160200 chr1B 275371025 275373372 2347 False 4337 4337 100.0000 1 2348 1 chr1B.!!$F1 2347
1 TraesCS1B01G160200 chr1B 275468297 275470654 2357 False 4036 4036 97.6250 1 2348 1 chr1B.!!$F2 2347
2 TraesCS1B01G160200 chr1B 275675891 275677988 2097 False 2883 2883 91.5050 69 2167 1 chr1B.!!$F5 2098
3 TraesCS1B01G160200 chr1B 275602163 275603636 1473 False 2394 2394 96.0780 883 2348 1 chr1B.!!$F4 1465
4 TraesCS1B01G160200 chr1B 275588729 275589614 885 False 1395 1395 95.0450 1 888 1 chr1B.!!$F3 887
5 TraesCS1B01G160200 chr1A 246089593 246090678 1085 True 1642 1642 93.9450 1079 2167 1 chr1A.!!$R2 1088
6 TraesCS1B01G160200 chr1A 246124343 246125286 943 True 1434 1434 94.0740 69 1013 1 chr1A.!!$R3 944
7 TraesCS1B01G160200 chr1A 245834250 245835348 1098 True 858 1040 94.5625 1037 2165 2 chr1A.!!$R4 1128
8 TraesCS1B01G160200 chr1A 245959805 245960326 521 True 809 809 94.6360 492 1013 1 chr1A.!!$R1 521

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
238 239 4.033776 CACCCACCCCATCGCACT 62.034 66.667 0.0 0.0 0.0 4.40 F
982 983 4.968553 TCCCTTGGAGAGAACCGT 57.031 55.556 0.0 0.0 0.0 4.83 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1204 1212 4.608948 AAGACTCATCCGAGAAAAGTGT 57.391 40.909 0.0 0.0 42.34 3.55 R
2283 2301 2.959516 TGTGTGTTCTTGGATCTAGCG 58.040 47.619 0.0 0.0 0.00 4.26 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
238 239 4.033776 CACCCACCCCATCGCACT 62.034 66.667 0.00 0.0 0.00 4.40
364 365 5.489249 GTGCAGATGAGATCATGGATATGT 58.511 41.667 0.00 0.0 36.57 2.29
787 788 5.123936 GGCAACGGAAAAGGACTCTATAAT 58.876 41.667 0.00 0.0 0.00 1.28
982 983 4.968553 TCCCTTGGAGAGAACCGT 57.031 55.556 0.00 0.0 0.00 4.83
1204 1212 4.821805 GTGATGAAAGAAGTGGAGGTTTGA 59.178 41.667 0.00 0.0 0.00 2.69
1540 1548 2.068519 CGTGTGCGATACATGGCATAT 58.931 47.619 0.00 0.0 43.26 1.78
1823 1831 4.017130 AGGGGATCAATTGTAGCCTTTCTT 60.017 41.667 5.13 0.0 0.00 2.52
1849 1857 4.497291 AGTAAGAGTGTCAAACCCAACA 57.503 40.909 0.00 0.0 0.00 3.33
2283 2301 8.668510 AATTGACTAGATCCAATCACACATAC 57.331 34.615 0.00 0.0 32.36 2.39
2322 2340 5.182570 CACACAAGAGGTCACAATGATTCAT 59.817 40.000 0.00 0.0 0.00 2.57
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
56 57 1.668101 GGTGCGGTTGTTGGGAAACA 61.668 55.000 0.00 0.00 0.00 2.83
364 365 6.216662 TCTCCCCTAGTATTTCCATTCAAACA 59.783 38.462 0.00 0.00 0.00 2.83
488 489 0.523757 GTACCTCGCGAGCTTCTCAC 60.524 60.000 30.49 15.59 0.00 3.51
582 583 6.602410 TCTGCATAAATCCAATCACCAAAA 57.398 33.333 0.00 0.00 0.00 2.44
787 788 4.099727 CCACCACATCCATATTCAAATGCA 59.900 41.667 0.00 0.00 0.00 3.96
982 983 3.727726 ACATGATATTCGTTGCATCCGA 58.272 40.909 0.00 5.01 0.00 4.55
1204 1212 4.608948 AAGACTCATCCGAGAAAAGTGT 57.391 40.909 0.00 0.00 42.34 3.55
1540 1548 7.766738 TCGCAAATAGTTTGTATGGATGAACTA 59.233 33.333 4.56 0.00 42.56 2.24
1823 1831 6.428083 TGGGTTTGACACTCTTACTTATCA 57.572 37.500 0.00 0.00 0.00 2.15
2283 2301 2.959516 TGTGTGTTCTTGGATCTAGCG 58.040 47.619 0.00 0.00 0.00 4.26
2322 2340 7.060421 ACCTTGTATCTTTCTTTTCTTGTCCA 58.940 34.615 0.00 0.00 0.00 4.02


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.