Multiple sequence alignment - TraesCS1B01G156500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G156500 chr1B 100.000 2318 0 0 1 2318 264341104 264343421 0 4281
1 TraesCS1B01G156500 chr1D 97.347 2337 40 7 1 2318 190762499 190764832 0 3952
2 TraesCS1B01G156500 chr1A 91.840 1299 69 17 181 1477 168553184 168554447 0 1777
3 TraesCS1B01G156500 chr1A 94.769 822 33 5 1505 2318 168554507 168555326 0 1271


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G156500 chr1B 264341104 264343421 2317 False 4281 4281 100.0000 1 2318 1 chr1B.!!$F1 2317
1 TraesCS1B01G156500 chr1D 190762499 190764832 2333 False 3952 3952 97.3470 1 2318 1 chr1D.!!$F1 2317
2 TraesCS1B01G156500 chr1A 168553184 168555326 2142 False 1524 1777 93.3045 181 2318 2 chr1A.!!$F1 2137

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
610 612 0.550914 TGTACGTATACCCTCCCCGT 59.449 55.0 0.0 0.0 35.68 5.28 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2174 2244 0.706433 ACCCCTGTGCCTCATTCATT 59.294 50.0 0.0 0.0 0.0 2.57 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
23 24 4.152223 CAGTATGCATTGTTGTTGTCTCGA 59.848 41.667 3.54 0.00 0.00 4.04
41 42 2.002586 CGACTAGGCCTTGATGTTGTG 58.997 52.381 21.63 2.24 0.00 3.33
42 43 2.612972 CGACTAGGCCTTGATGTTGTGT 60.613 50.000 21.63 0.00 0.00 3.72
43 44 3.003480 GACTAGGCCTTGATGTTGTGTC 58.997 50.000 21.63 1.35 0.00 3.67
57 58 3.487942 TGTTGTGTCGTCGTTGATGTAAG 59.512 43.478 0.00 0.00 0.00 2.34
249 250 1.123077 ACGGGCAGAGCTATGATGAA 58.877 50.000 13.69 0.00 0.00 2.57
610 612 0.550914 TGTACGTATACCCTCCCCGT 59.449 55.000 0.00 0.00 35.68 5.28
805 811 1.617018 CGCCTTCTCCATCACTCCCA 61.617 60.000 0.00 0.00 0.00 4.37
867 873 0.746204 TTCCACGCACACACACACAT 60.746 50.000 0.00 0.00 0.00 3.21
1414 1434 1.696832 GAAATCTCACCGCTCGTGGC 61.697 60.000 0.00 0.00 43.23 5.01
1614 1684 3.563808 TCATGTATACATTCTTTGCGGCC 59.436 43.478 15.85 0.00 33.61 6.13
2133 2203 0.599991 CAAGGGGAAACAAAAGCGGC 60.600 55.000 0.00 0.00 0.00 6.53
2174 2244 0.034198 TGCAAATCACGTTCGGGAGA 59.966 50.000 3.14 0.00 0.00 3.71
2192 2262 1.064166 AGAATGAATGAGGCACAGGGG 60.064 52.381 0.00 0.00 0.00 4.79
2228 2298 5.964958 CTTCTGGAGCAAATTCCTTTACA 57.035 39.130 0.00 0.00 38.12 2.41
2231 2301 2.817258 TGGAGCAAATTCCTTTACACGG 59.183 45.455 0.00 0.00 38.12 4.94
2269 2339 5.809562 AGTTCTTTCGCATTCTCTGTCATAG 59.190 40.000 0.00 0.00 0.00 2.23
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
11 12 1.272769 AGGCCTAGTCGAGACAACAAC 59.727 52.381 1.29 0.0 0.00 3.32
23 24 2.612972 CGACACAACATCAAGGCCTAGT 60.613 50.000 5.16 0.0 0.00 2.57
41 42 6.290956 GCTATAACACTTACATCAACGACGAC 60.291 42.308 0.00 0.0 0.00 4.34
42 43 5.740569 GCTATAACACTTACATCAACGACGA 59.259 40.000 0.00 0.0 0.00 4.20
43 44 5.742453 AGCTATAACACTTACATCAACGACG 59.258 40.000 0.00 0.0 0.00 5.12
249 250 2.125512 GCGAAGGTGAGCGGTCAT 60.126 61.111 21.66 4.5 34.36 3.06
867 873 7.811236 GCTTATATATAAGGCGAGTGTGTGTAA 59.189 37.037 26.50 0.0 40.01 2.41
1414 1434 2.138831 GGGGTAGAAGTAGGGCCCG 61.139 68.421 18.44 0.0 40.18 6.13
2133 2203 3.502211 AGGTATTGCAACTTTGAACCGAG 59.498 43.478 0.00 0.0 0.00 4.63
2174 2244 0.706433 ACCCCTGTGCCTCATTCATT 59.294 50.000 0.00 0.0 0.00 2.57
2192 2262 1.876156 CCAGAAGCACAGTTCCAAGAC 59.124 52.381 0.00 0.0 0.00 3.01


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.