Multiple sequence alignment - TraesCS1B01G151000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G151000 chr1B 100.000 2369 0 0 1 2369 235381390 235383758 0.000000e+00 4375.0
1 TraesCS1B01G151000 chr2A 99.041 1773 16 1 597 2369 349225305 349223534 0.000000e+00 3179.0
2 TraesCS1B01G151000 chr2A 98.644 959 13 0 596 1554 590787113 590786155 0.000000e+00 1700.0
3 TraesCS1B01G151000 chr2A 90.079 252 18 3 2118 2369 397630057 397630301 1.060000e-83 320.0
4 TraesCS1B01G151000 chr3B 99.052 949 9 0 606 1554 793118618 793119566 0.000000e+00 1703.0
5 TraesCS1B01G151000 chr3B 98.433 957 15 0 598 1554 169349155 169348199 0.000000e+00 1685.0
6 TraesCS1B01G151000 chr3B 96.491 570 18 2 1 568 370166813 370166244 0.000000e+00 941.0
7 TraesCS1B01G151000 chr3B 89.438 587 51 9 1 580 365107071 365106489 0.000000e+00 730.0
8 TraesCS1B01G151000 chr3B 79.766 598 77 22 19 598 950193 950764 6.140000e-106 394.0
9 TraesCS1B01G151000 chr3B 81.765 170 28 3 472 641 22079615 22079449 3.170000e-29 139.0
10 TraesCS1B01G151000 chr3B 86.614 127 16 1 472 598 736483518 736483393 3.170000e-29 139.0
11 TraesCS1B01G151000 chr7B 98.747 958 9 2 597 1554 721298086 721299040 0.000000e+00 1700.0
12 TraesCS1B01G151000 chr7B 99.753 809 2 0 1561 2369 495191890 495191082 0.000000e+00 1483.0
13 TraesCS1B01G151000 chr7B 99.629 809 3 0 1561 2369 7017228 7018036 0.000000e+00 1478.0
14 TraesCS1B01G151000 chr7B 79.043 606 69 35 5 598 513688514 513687955 1.730000e-96 363.0
15 TraesCS1B01G151000 chr7B 86.047 129 15 3 468 594 23443444 23443317 4.110000e-28 135.0
16 TraesCS1B01G151000 chr6B 98.333 960 16 0 595 1554 474539977 474540936 0.000000e+00 1685.0
17 TraesCS1B01G151000 chr6B 98.000 950 17 2 606 1554 232741620 232742568 0.000000e+00 1648.0
18 TraesCS1B01G151000 chr3A 98.629 948 13 0 607 1554 721633093 721632146 0.000000e+00 1679.0
19 TraesCS1B01G151000 chr6A 98.225 958 15 2 597 1554 462594587 462593632 0.000000e+00 1674.0
20 TraesCS1B01G151000 chr6A 99.753 809 2 0 1561 2369 606314357 606315165 0.000000e+00 1483.0
21 TraesCS1B01G151000 chr6A 96.021 578 21 2 1 577 425897104 425897680 0.000000e+00 939.0
22 TraesCS1B01G151000 chr6A 96.175 549 19 1 31 577 425898237 425898785 0.000000e+00 896.0
23 TraesCS1B01G151000 chr6A 95.985 548 21 1 31 577 425897685 425898232 0.000000e+00 889.0
24 TraesCS1B01G151000 chr4A 99.753 809 2 0 1561 2369 104128806 104127998 0.000000e+00 1483.0
25 TraesCS1B01G151000 chr4A 86.680 488 58 7 1629 2110 351156014 351155528 3.470000e-148 534.0
26 TraesCS1B01G151000 chr5A 95.015 662 15 1 578 1239 46483008 46483651 0.000000e+00 1024.0
27 TraesCS1B01G151000 chr2B 95.139 576 16 6 1 568 554726718 554726147 0.000000e+00 898.0
28 TraesCS1B01G151000 chr2B 79.967 614 80 25 2 595 708795493 708794903 1.690000e-111 412.0
29 TraesCS1B01G151000 chr2B 80.662 574 73 19 44 598 197576314 197575760 6.090000e-111 411.0
30 TraesCS1B01G151000 chr2B 92.000 250 12 5 2121 2369 127154753 127154511 6.270000e-91 344.0
31 TraesCS1B01G151000 chr7D 86.106 583 72 7 2 577 179629944 179629364 9.300000e-174 619.0
32 TraesCS1B01G151000 chr7D 84.957 585 68 11 2 579 486550325 486549754 2.040000e-160 575.0
33 TraesCS1B01G151000 chr7A 86.679 563 53 18 1561 2110 11259209 11259762 2.600000e-169 604.0
34 TraesCS1B01G151000 chr7A 80.597 134 19 7 472 598 2013869 2013736 1.940000e-16 97.1
35 TraesCS1B01G151000 chr3D 86.226 530 60 11 1588 2110 368184639 368184116 1.590000e-156 562.0
36 TraesCS1B01G151000 chr3D 91.700 253 13 6 2118 2369 141503822 141504067 6.270000e-91 344.0
37 TraesCS1B01G151000 chr4B 83.497 612 73 21 3 598 428877959 428878558 1.600000e-151 545.0
38 TraesCS1B01G151000 chr5D 85.864 382 48 3 1705 2083 74363040 74362662 3.670000e-108 401.0
39 TraesCS1B01G151000 chr5B 91.700 253 13 6 2118 2369 71791499 71791744 6.270000e-91 344.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G151000 chr1B 235381390 235383758 2368 False 4375 4375 100.000000 1 2369 1 chr1B.!!$F1 2368
1 TraesCS1B01G151000 chr2A 349223534 349225305 1771 True 3179 3179 99.041000 597 2369 1 chr2A.!!$R1 1772
2 TraesCS1B01G151000 chr2A 590786155 590787113 958 True 1700 1700 98.644000 596 1554 1 chr2A.!!$R2 958
3 TraesCS1B01G151000 chr3B 793118618 793119566 948 False 1703 1703 99.052000 606 1554 1 chr3B.!!$F2 948
4 TraesCS1B01G151000 chr3B 169348199 169349155 956 True 1685 1685 98.433000 598 1554 1 chr3B.!!$R2 956
5 TraesCS1B01G151000 chr3B 370166244 370166813 569 True 941 941 96.491000 1 568 1 chr3B.!!$R4 567
6 TraesCS1B01G151000 chr3B 365106489 365107071 582 True 730 730 89.438000 1 580 1 chr3B.!!$R3 579
7 TraesCS1B01G151000 chr3B 950193 950764 571 False 394 394 79.766000 19 598 1 chr3B.!!$F1 579
8 TraesCS1B01G151000 chr7B 721298086 721299040 954 False 1700 1700 98.747000 597 1554 1 chr7B.!!$F2 957
9 TraesCS1B01G151000 chr7B 495191082 495191890 808 True 1483 1483 99.753000 1561 2369 1 chr7B.!!$R2 808
10 TraesCS1B01G151000 chr7B 7017228 7018036 808 False 1478 1478 99.629000 1561 2369 1 chr7B.!!$F1 808
11 TraesCS1B01G151000 chr7B 513687955 513688514 559 True 363 363 79.043000 5 598 1 chr7B.!!$R3 593
12 TraesCS1B01G151000 chr6B 474539977 474540936 959 False 1685 1685 98.333000 595 1554 1 chr6B.!!$F2 959
13 TraesCS1B01G151000 chr6B 232741620 232742568 948 False 1648 1648 98.000000 606 1554 1 chr6B.!!$F1 948
14 TraesCS1B01G151000 chr3A 721632146 721633093 947 True 1679 1679 98.629000 607 1554 1 chr3A.!!$R1 947
15 TraesCS1B01G151000 chr6A 462593632 462594587 955 True 1674 1674 98.225000 597 1554 1 chr6A.!!$R1 957
16 TraesCS1B01G151000 chr6A 606314357 606315165 808 False 1483 1483 99.753000 1561 2369 1 chr6A.!!$F1 808
17 TraesCS1B01G151000 chr6A 425897104 425898785 1681 False 908 939 96.060333 1 577 3 chr6A.!!$F2 576
18 TraesCS1B01G151000 chr4A 104127998 104128806 808 True 1483 1483 99.753000 1561 2369 1 chr4A.!!$R1 808
19 TraesCS1B01G151000 chr5A 46483008 46483651 643 False 1024 1024 95.015000 578 1239 1 chr5A.!!$F1 661
20 TraesCS1B01G151000 chr2B 554726147 554726718 571 True 898 898 95.139000 1 568 1 chr2B.!!$R3 567
21 TraesCS1B01G151000 chr2B 708794903 708795493 590 True 412 412 79.967000 2 595 1 chr2B.!!$R4 593
22 TraesCS1B01G151000 chr2B 197575760 197576314 554 True 411 411 80.662000 44 598 1 chr2B.!!$R2 554
23 TraesCS1B01G151000 chr7D 179629364 179629944 580 True 619 619 86.106000 2 577 1 chr7D.!!$R1 575
24 TraesCS1B01G151000 chr7D 486549754 486550325 571 True 575 575 84.957000 2 579 1 chr7D.!!$R2 577
25 TraesCS1B01G151000 chr7A 11259209 11259762 553 False 604 604 86.679000 1561 2110 1 chr7A.!!$F1 549
26 TraesCS1B01G151000 chr3D 368184116 368184639 523 True 562 562 86.226000 1588 2110 1 chr3D.!!$R1 522
27 TraesCS1B01G151000 chr4B 428877959 428878558 599 False 545 545 83.497000 3 598 1 chr4B.!!$F1 595

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
694 1834 2.154462 CAAGAATTCAACCCGCAGTCT 58.846 47.619 8.44 0.0 0.0 3.24 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2134 3306 1.610522 GACTTTCAGGTGTGCAGCATT 59.389 47.619 0.0 0.0 0.0 3.56 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
469 1604 6.147000 CGATTTTTGGTCCGGAAAATTGAAAT 59.853 34.615 16.78 13.27 38.22 2.17
694 1834 2.154462 CAAGAATTCAACCCGCAGTCT 58.846 47.619 8.44 0.00 0.00 3.24
1303 2461 0.783206 TTCCTTCCCTTCCCATGCAA 59.217 50.000 0.00 0.00 0.00 4.08
1371 2529 4.215908 CCTCTGCTACACCAAGATAGGTA 58.784 47.826 0.00 0.00 40.77 3.08
2134 3306 7.608376 TCATCCATAAATCACGAAAAAGGTACA 59.392 33.333 0.00 0.00 0.00 2.90
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
694 1834 2.542550 TCCCCGATCCACTTAAACAGA 58.457 47.619 0.00 0.00 0.00 3.41
1042 2200 4.974438 AGGGACGAACCTGGGCCA 62.974 66.667 5.85 5.85 40.04 5.36
1371 2529 2.239907 GAGAGTAGATGGGGGTTGCTTT 59.760 50.000 0.00 0.00 0.00 3.51
1438 2596 4.771903 TGGACTTGTTTGTGTAGTAGCAA 58.228 39.130 0.00 0.00 0.00 3.91
1549 2708 2.032030 CAGGGCAGAGTTTGTGTTTACG 60.032 50.000 0.00 0.00 0.00 3.18
2134 3306 1.610522 GACTTTCAGGTGTGCAGCATT 59.389 47.619 0.00 0.00 0.00 3.56


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.