Multiple sequence alignment - TraesCS1B01G150300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G150300 chr1B 100.000 2856 0 0 1 2856 229534309 229537164 0.000000e+00 5275.0
1 TraesCS1B01G150300 chr2A 99.004 2109 18 3 750 2856 740731846 740733953 0.000000e+00 3775.0
2 TraesCS1B01G150300 chr2A 96.785 1462 39 5 1402 2856 157904809 157906269 0.000000e+00 2433.0
3 TraesCS1B01G150300 chr2A 92.822 613 24 7 746 1357 157904214 157904807 0.000000e+00 870.0
4 TraesCS1B01G150300 chr2A 85.300 517 49 13 1 506 4799851 4800351 2.540000e-140 508.0
5 TraesCS1B01G150300 chr2A 93.750 64 4 0 691 754 736254808 736254871 2.340000e-16 97.1
6 TraesCS1B01G150300 chr4A 99.027 2056 17 3 803 2856 536327800 536329854 0.000000e+00 3683.0
7 TraesCS1B01G150300 chr4A 90.980 765 42 9 1 754 513074446 513075194 0.000000e+00 1005.0
8 TraesCS1B01G150300 chr4A 84.665 626 65 19 989 1591 13064211 13063594 1.890000e-166 595.0
9 TraesCS1B01G150300 chr4A 83.784 185 24 6 750 932 527951067 527951247 1.360000e-38 171.0
10 TraesCS1B01G150300 chr3B 92.617 2113 131 13 754 2856 98704015 98701918 0.000000e+00 3014.0
11 TraesCS1B01G150300 chr3B 96.159 1432 37 7 1435 2856 810404761 810403338 0.000000e+00 2324.0
12 TraesCS1B01G150300 chr3B 97.647 765 6 2 1 754 341335490 341334727 0.000000e+00 1303.0
13 TraesCS1B01G150300 chr3B 97.796 363 6 2 392 754 18411213 18411573 2.420000e-175 625.0
14 TraesCS1B01G150300 chr3B 86.577 298 4 9 1 287 18410942 18411214 2.150000e-76 296.0
15 TraesCS1B01G150300 chr5B 90.956 2112 157 17 754 2856 190587701 190585615 0.000000e+00 2811.0
16 TraesCS1B01G150300 chr6B 96.441 1433 39 5 1435 2856 21201660 21203091 0.000000e+00 2353.0
17 TraesCS1B01G150300 chr6A 96.017 1431 40 7 1435 2856 568064114 568062692 0.000000e+00 2311.0
18 TraesCS1B01G150300 chr7B 91.932 818 56 7 1587 2397 263145816 263145002 0.000000e+00 1136.0
19 TraesCS1B01G150300 chr7B 93.261 460 26 3 2398 2856 263144957 263144502 0.000000e+00 673.0
20 TraesCS1B01G150300 chr7B 86.067 445 33 10 1169 1591 263146278 263145841 4.340000e-123 451.0
21 TraesCS1B01G150300 chr7B 83.333 180 22 8 756 932 723879814 723879988 2.950000e-35 159.0
22 TraesCS1B01G150300 chr7A 91.123 766 42 9 1 754 595838879 595839630 0.000000e+00 1014.0
23 TraesCS1B01G150300 chr4D 87.789 606 59 9 992 1591 386539407 386538811 0.000000e+00 695.0
24 TraesCS1B01G150300 chr4D 84.946 465 47 9 62 513 489111643 489111189 1.560000e-122 449.0
25 TraesCS1B01G150300 chr1A 83.946 517 55 13 1 506 376210894 376211393 1.200000e-128 470.0
26 TraesCS1B01G150300 chrUn 84.123 422 54 10 1982 2397 289122453 289122039 2.060000e-106 396.0
27 TraesCS1B01G150300 chrUn 88.000 150 12 5 750 897 371871178 371871033 3.780000e-39 172.0
28 TraesCS1B01G150300 chrUn 88.000 150 12 5 750 897 431173253 431173398 3.780000e-39 172.0
29 TraesCS1B01G150300 chr4B 76.528 409 62 21 152 553 41316205 41315824 2.900000e-45 193.0
30 TraesCS1B01G150300 chr6D 74.550 389 52 30 1165 1538 443265976 443265620 2.990000e-25 126.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G150300 chr1B 229534309 229537164 2855 False 5275.000000 5275 100.0000 1 2856 1 chr1B.!!$F1 2855
1 TraesCS1B01G150300 chr2A 740731846 740733953 2107 False 3775.000000 3775 99.0040 750 2856 1 chr2A.!!$F3 2106
2 TraesCS1B01G150300 chr2A 157904214 157906269 2055 False 1651.500000 2433 94.8035 746 2856 2 chr2A.!!$F4 2110
3 TraesCS1B01G150300 chr2A 4799851 4800351 500 False 508.000000 508 85.3000 1 506 1 chr2A.!!$F1 505
4 TraesCS1B01G150300 chr4A 536327800 536329854 2054 False 3683.000000 3683 99.0270 803 2856 1 chr4A.!!$F3 2053
5 TraesCS1B01G150300 chr4A 513074446 513075194 748 False 1005.000000 1005 90.9800 1 754 1 chr4A.!!$F1 753
6 TraesCS1B01G150300 chr4A 13063594 13064211 617 True 595.000000 595 84.6650 989 1591 1 chr4A.!!$R1 602
7 TraesCS1B01G150300 chr3B 98701918 98704015 2097 True 3014.000000 3014 92.6170 754 2856 1 chr3B.!!$R1 2102
8 TraesCS1B01G150300 chr3B 810403338 810404761 1423 True 2324.000000 2324 96.1590 1435 2856 1 chr3B.!!$R3 1421
9 TraesCS1B01G150300 chr3B 341334727 341335490 763 True 1303.000000 1303 97.6470 1 754 1 chr3B.!!$R2 753
10 TraesCS1B01G150300 chr3B 18410942 18411573 631 False 460.500000 625 92.1865 1 754 2 chr3B.!!$F1 753
11 TraesCS1B01G150300 chr5B 190585615 190587701 2086 True 2811.000000 2811 90.9560 754 2856 1 chr5B.!!$R1 2102
12 TraesCS1B01G150300 chr6B 21201660 21203091 1431 False 2353.000000 2353 96.4410 1435 2856 1 chr6B.!!$F1 1421
13 TraesCS1B01G150300 chr6A 568062692 568064114 1422 True 2311.000000 2311 96.0170 1435 2856 1 chr6A.!!$R1 1421
14 TraesCS1B01G150300 chr7B 263144502 263146278 1776 True 753.333333 1136 90.4200 1169 2856 3 chr7B.!!$R1 1687
15 TraesCS1B01G150300 chr7A 595838879 595839630 751 False 1014.000000 1014 91.1230 1 754 1 chr7A.!!$F1 753
16 TraesCS1B01G150300 chr4D 386538811 386539407 596 True 695.000000 695 87.7890 992 1591 1 chr4D.!!$R1 599

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1357 1426 2.125793 GACCACCCCTTACGACGC 60.126 66.667 0.0 0.0 0.0 5.19 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2330 2450 1.171308 CCAAGCAGAAGGGTGACATG 58.829 55.0 0.0 0.0 0.0 3.21 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1357 1426 2.125793 GACCACCCCTTACGACGC 60.126 66.667 0.0 0.0 0.00 5.19
1523 1602 1.890174 GCCTAACACCATGTTGGCC 59.110 57.895 17.3 0.0 42.87 5.36
2330 2450 6.773976 TCAGAATAATTTGATGAACCACCC 57.226 37.500 0.0 0.0 0.00 4.61
2382 2502 4.510038 AGCAATTTACAAAGCTCCAGTG 57.490 40.909 0.0 0.0 30.05 3.66
2462 2626 7.900782 ACTGTTGTTGTTATGTATGTAGGAC 57.099 36.000 0.0 0.0 0.00 3.85
2824 2994 7.703058 ACGAATTATCCTGAGGTTCAATTTT 57.297 32.000 0.0 0.0 0.00 1.82
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
734 763 0.396417 ACTAGATCAGGAGTGGCGCT 60.396 55.000 7.64 0.0 0.00 5.92
1276 1344 2.516460 ACCGGATCCCTCGTCTCG 60.516 66.667 9.46 0.0 0.00 4.04
1357 1426 3.709880 TAGCCGTCGACGCCAATGG 62.710 63.158 31.73 17.9 38.18 3.16
1523 1602 1.280457 AACCAGAGGGGCAGAAGTAG 58.720 55.000 0.00 0.0 42.05 2.57
2330 2450 1.171308 CCAAGCAGAAGGGTGACATG 58.829 55.000 0.00 0.0 0.00 3.21
2382 2502 2.952310 GGAATCAAGGCTGTATTGACCC 59.048 50.000 0.00 0.0 39.36 4.46
2462 2626 9.881649 ATATCCTGCATACAACTCTATATTGTG 57.118 33.333 0.72 0.0 40.47 3.33


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.