Multiple sequence alignment - TraesCS1B01G149200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G149200 chr1B 100.000 2393 0 0 1 2393 221277523 221279915 0.000000e+00 4420
1 TraesCS1B01G149200 chr1B 96.896 1514 45 2 1 1514 660751537 660753048 0.000000e+00 2534
2 TraesCS1B01G149200 chr1B 97.843 881 14 2 1513 2393 221299898 221300773 0.000000e+00 1517
3 TraesCS1B01G149200 chr1B 96.599 882 25 2 1512 2393 221309714 221310590 0.000000e+00 1458
4 TraesCS1B01G149200 chr1B 85.689 559 56 14 1527 2082 573615788 573615251 3.450000e-158 568
5 TraesCS1B01G149200 chr1B 91.429 105 6 3 1418 1519 137438650 137438754 8.920000e-30 141
6 TraesCS1B01G149200 chr5B 97.096 1515 43 1 1 1515 41257341 41255828 0.000000e+00 2553
7 TraesCS1B01G149200 chr5B 90.169 1475 138 6 43 1514 448646374 448644904 0.000000e+00 1914
8 TraesCS1B01G149200 chr5B 86.730 1477 177 13 1 1472 258520371 258518909 0.000000e+00 1624
9 TraesCS1B01G149200 chr5B 84.646 508 50 14 1513 2014 167287365 167286880 4.630000e-132 481
10 TraesCS1B01G149200 chr3B 91.534 1512 111 6 4 1515 256881250 256879756 0.000000e+00 2067
11 TraesCS1B01G149200 chr3B 86.588 1521 181 14 1 1515 766817820 766819323 0.000000e+00 1657
12 TraesCS1B01G149200 chr3B 85.691 615 72 6 902 1514 786078623 786078023 3.360000e-178 634
13 TraesCS1B01G149200 chr4B 87.048 1521 178 12 1 1514 596354692 596356200 0.000000e+00 1700
14 TraesCS1B01G149200 chr4B 86.552 870 82 21 1527 2390 290784054 290784894 0.000000e+00 926
15 TraesCS1B01G149200 chr4A 85.403 1514 196 15 5 1514 719162201 719163693 0.000000e+00 1548
16 TraesCS1B01G149200 chr7B 85.431 1414 201 5 1 1411 529998181 529999592 0.000000e+00 1465
17 TraesCS1B01G149200 chr7B 93.644 881 29 7 1513 2393 474550802 474551655 0.000000e+00 1291
18 TraesCS1B01G149200 chr6B 95.346 881 27 2 1513 2393 462909746 462908880 0.000000e+00 1387
19 TraesCS1B01G149200 chr3A 82.512 1521 247 13 12 1529 110312748 110311244 0.000000e+00 1317
20 TraesCS1B01G149200 chr6A 81.225 1518 257 17 2 1516 187765341 187763849 0.000000e+00 1199
21 TraesCS1B01G149200 chr6A 86.431 877 79 22 1513 2380 356281235 356282080 0.000000e+00 924
22 TraesCS1B01G149200 chr2B 86.191 869 88 19 1527 2390 114914707 114913866 0.000000e+00 911
23 TraesCS1B01G149200 chrUn 85.632 870 93 21 1527 2390 266287725 266288568 0.000000e+00 885
24 TraesCS1B01G149200 chr6D 84.738 878 79 30 1513 2378 326412399 326413233 0.000000e+00 828
25 TraesCS1B01G149200 chr1D 86.695 699 58 19 1513 2204 61441219 61441889 0.000000e+00 743


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G149200 chr1B 221277523 221279915 2392 False 4420 4420 100.000 1 2393 1 chr1B.!!$F2 2392
1 TraesCS1B01G149200 chr1B 660751537 660753048 1511 False 2534 2534 96.896 1 1514 1 chr1B.!!$F5 1513
2 TraesCS1B01G149200 chr1B 221299898 221300773 875 False 1517 1517 97.843 1513 2393 1 chr1B.!!$F3 880
3 TraesCS1B01G149200 chr1B 221309714 221310590 876 False 1458 1458 96.599 1512 2393 1 chr1B.!!$F4 881
4 TraesCS1B01G149200 chr1B 573615251 573615788 537 True 568 568 85.689 1527 2082 1 chr1B.!!$R1 555
5 TraesCS1B01G149200 chr5B 41255828 41257341 1513 True 2553 2553 97.096 1 1515 1 chr5B.!!$R1 1514
6 TraesCS1B01G149200 chr5B 448644904 448646374 1470 True 1914 1914 90.169 43 1514 1 chr5B.!!$R4 1471
7 TraesCS1B01G149200 chr5B 258518909 258520371 1462 True 1624 1624 86.730 1 1472 1 chr5B.!!$R3 1471
8 TraesCS1B01G149200 chr3B 256879756 256881250 1494 True 2067 2067 91.534 4 1515 1 chr3B.!!$R1 1511
9 TraesCS1B01G149200 chr3B 766817820 766819323 1503 False 1657 1657 86.588 1 1515 1 chr3B.!!$F1 1514
10 TraesCS1B01G149200 chr3B 786078023 786078623 600 True 634 634 85.691 902 1514 1 chr3B.!!$R2 612
11 TraesCS1B01G149200 chr4B 596354692 596356200 1508 False 1700 1700 87.048 1 1514 1 chr4B.!!$F2 1513
12 TraesCS1B01G149200 chr4B 290784054 290784894 840 False 926 926 86.552 1527 2390 1 chr4B.!!$F1 863
13 TraesCS1B01G149200 chr4A 719162201 719163693 1492 False 1548 1548 85.403 5 1514 1 chr4A.!!$F1 1509
14 TraesCS1B01G149200 chr7B 529998181 529999592 1411 False 1465 1465 85.431 1 1411 1 chr7B.!!$F2 1410
15 TraesCS1B01G149200 chr7B 474550802 474551655 853 False 1291 1291 93.644 1513 2393 1 chr7B.!!$F1 880
16 TraesCS1B01G149200 chr6B 462908880 462909746 866 True 1387 1387 95.346 1513 2393 1 chr6B.!!$R1 880
17 TraesCS1B01G149200 chr3A 110311244 110312748 1504 True 1317 1317 82.512 12 1529 1 chr3A.!!$R1 1517
18 TraesCS1B01G149200 chr6A 187763849 187765341 1492 True 1199 1199 81.225 2 1516 1 chr6A.!!$R1 1514
19 TraesCS1B01G149200 chr6A 356281235 356282080 845 False 924 924 86.431 1513 2380 1 chr6A.!!$F1 867
20 TraesCS1B01G149200 chr2B 114913866 114914707 841 True 911 911 86.191 1527 2390 1 chr2B.!!$R1 863
21 TraesCS1B01G149200 chrUn 266287725 266288568 843 False 885 885 85.632 1527 2390 1 chrUn.!!$F1 863
22 TraesCS1B01G149200 chr6D 326412399 326413233 834 False 828 828 84.738 1513 2378 1 chr6D.!!$F1 865
23 TraesCS1B01G149200 chr1D 61441219 61441889 670 False 743 743 86.695 1513 2204 1 chr1D.!!$F1 691

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
911 912 0.665369 GACGTAACTGACCCACACCG 60.665 60.0 0.0 0.0 0.0 4.94 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2333 2368 5.699458 CCAAGCTTTCAATGCATTTTTCTCT 59.301 36.0 9.83 1.94 0.0 3.1 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
106 107 3.785887 ACTATCTCCTACCAAATTGCCCA 59.214 43.478 0.00 0.0 0.00 5.36
132 133 5.324409 ACAGCTTTTGACCCAATCATAGAA 58.676 37.500 0.00 0.0 37.11 2.10
288 289 4.672587 AGCTAAACTAGATGCCATTCGA 57.327 40.909 0.00 0.0 0.00 3.71
443 444 7.115947 CCTGCTCATGAAATTCTCTTCAAAAAC 59.884 37.037 0.00 0.0 38.75 2.43
781 782 0.687757 AGCCCGAGAGCTGGATTGTA 60.688 55.000 0.00 0.0 42.95 2.41
828 829 1.666872 GGTGAACCAACCGGACGAG 60.667 63.158 9.46 0.0 35.59 4.18
911 912 0.665369 GACGTAACTGACCCACACCG 60.665 60.000 0.00 0.0 0.00 4.94
920 921 2.509336 CCCACACCGTGATCTCGC 60.509 66.667 11.58 0.0 35.23 5.03
1388 1389 1.434188 TTCCTTTCCTCAGCTGTCCA 58.566 50.000 14.67 0.0 0.00 4.02
1508 1520 2.255881 CCCCGGTGACCGTTCAAAC 61.256 63.158 23.73 0.0 46.80 2.93
1916 1944 4.610945 GACCATGAACAAACAGGAAACAG 58.389 43.478 0.00 0.0 0.00 3.16
1970 2000 2.292828 ACAAAACTATGCAGGCTGGT 57.707 45.000 17.64 2.1 0.00 4.00
2084 2115 1.073923 GACATCAGTCCCCAGTTTGGT 59.926 52.381 0.00 0.0 38.89 3.67
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
106 107 3.499338 TGATTGGGTCAAAAGCTGTCAT 58.501 40.909 0.00 0.00 32.78 3.06
132 133 5.596772 TCCAAAGAGGAATTTCCGAAAGTTT 59.403 36.000 9.77 4.29 45.65 2.66
288 289 1.640917 TAGACCAGAAGAACGCCCTT 58.359 50.000 0.00 0.00 0.00 3.95
443 444 1.232119 GACGTTTGGGTGTTGTAGGG 58.768 55.000 0.00 0.00 0.00 3.53
490 491 3.350219 TGAAGTAATGCCAAGAGGGTC 57.650 47.619 0.00 0.00 39.65 4.46
781 782 0.824595 TCCTGCAGCAACAACAGCAT 60.825 50.000 8.66 0.00 36.28 3.79
911 912 1.522580 GAGGCCCAAGCGAGATCAC 60.523 63.158 0.00 0.00 41.24 3.06
1366 1367 3.181429 TGGACAGCTGAGGAAAGGAAATT 60.181 43.478 23.35 0.00 0.00 1.82
1916 1944 6.246420 ACTGTGTCTGAGAAAAACATATGC 57.754 37.500 1.58 0.00 0.00 3.14
2084 2115 7.292319 ACCTAAAGCCTTTTAAGAGTTAACCA 58.708 34.615 0.88 0.00 0.00 3.67
2333 2368 5.699458 CCAAGCTTTCAATGCATTTTTCTCT 59.301 36.000 9.83 1.94 0.00 3.10


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.