Multiple sequence alignment - TraesCS1B01G133500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G133500 chr1B 100.000 5540 0 0 1 5540 168969498 168975037 0.000000e+00 10194.0
1 TraesCS1B01G133500 chr1B 100.000 790 0 0 744 1533 168988030 168988819 0.000000e+00 1459.0
2 TraesCS1B01G133500 chr1B 95.760 283 12 0 2495 2777 565953450 565953732 1.820000e-124 457.0
3 TraesCS1B01G133500 chr1B 100.000 201 0 0 1 201 168987819 168988019 6.780000e-99 372.0
4 TraesCS1B01G133500 chr1B 100.000 191 0 0 1544 1734 168989153 168989343 2.460000e-93 353.0
5 TraesCS1B01G133500 chr1B 90.541 222 20 1 348 568 168969621 168969842 5.430000e-75 292.0
6 TraesCS1B01G133500 chr1B 90.541 222 20 1 124 345 168969845 168970065 5.430000e-75 292.0
7 TraesCS1B01G133500 chr1B 90.647 139 9 4 5237 5371 390622442 390622304 1.230000e-41 182.0
8 TraesCS1B01G133500 chr1B 87.069 116 14 1 2374 2489 168988970 168989084 4.500000e-26 130.0
9 TraesCS1B01G133500 chr1B 91.304 46 4 0 2080 2125 168971516 168971561 4.630000e-06 63.9
10 TraesCS1B01G133500 chr1B 91.304 46 4 0 2019 2064 168971577 168971622 4.630000e-06 63.9
11 TraesCS1B01G133500 chr1B 100.000 28 0 0 5502 5529 5247500 5247527 1.000000e-02 52.8
12 TraesCS1B01G133500 chr1A 93.327 2053 110 9 2898 4924 116695799 116697850 0.000000e+00 3007.0
13 TraesCS1B01G133500 chr1A 84.749 918 67 32 480 1352 116693610 116694499 0.000000e+00 852.0
14 TraesCS1B01G133500 chr1A 97.080 274 8 0 2499 2772 584712372 584712099 3.910000e-126 462.0
15 TraesCS1B01G133500 chr1A 84.501 471 41 13 5059 5498 116698183 116698652 2.370000e-118 436.0
16 TraesCS1B01G133500 chr1A 95.652 138 4 2 2792 2929 116695556 116695691 2.600000e-53 220.0
17 TraesCS1B01G133500 chr1A 84.298 242 16 4 1282 1501 116694465 116694706 3.360000e-52 217.0
18 TraesCS1B01G133500 chr1A 87.407 135 14 3 5250 5382 385659268 385659135 9.610000e-33 152.0
19 TraesCS1B01G133500 chr1A 87.705 122 14 1 2376 2497 116695215 116695335 2.080000e-29 141.0
20 TraesCS1B01G133500 chr1A 93.103 87 6 0 256 342 116693610 116693696 1.620000e-25 128.0
21 TraesCS1B01G133500 chr1D 92.720 989 41 10 3879 4837 110734929 110735916 0.000000e+00 1399.0
22 TraesCS1B01G133500 chr1D 93.677 854 51 3 3025 3875 110733967 110734820 0.000000e+00 1275.0
23 TraesCS1B01G133500 chr1D 85.531 857 71 31 687 1527 110731749 110732568 0.000000e+00 846.0
24 TraesCS1B01G133500 chr1D 87.246 345 25 10 1 345 110731016 110731341 5.240000e-100 375.0
25 TraesCS1B01G133500 chr1D 86.640 247 30 3 5253 5498 110771038 110771282 2.540000e-68 270.0
26 TraesCS1B01G133500 chr1D 92.308 156 3 3 2774 2929 110732813 110732959 4.350000e-51 213.0
27 TraesCS1B01G133500 chr1D 90.123 162 6 3 2889 3040 110733041 110733202 9.410000e-48 202.0
28 TraesCS1B01G133500 chr1D 81.893 243 14 9 5096 5309 110770786 110771027 1.590000e-40 178.0
29 TraesCS1B01G133500 chr1D 97.260 73 0 1 1282 1352 110732363 110732435 7.540000e-24 122.0
30 TraesCS1B01G133500 chr6B 97.122 278 8 0 2497 2774 280999786 280999509 2.340000e-128 470.0
31 TraesCS1B01G133500 chr6B 96.043 278 11 0 2497 2774 75528692 75528969 2.350000e-123 453.0
32 TraesCS1B01G133500 chr6B 87.143 140 17 1 5244 5382 542930616 542930755 2.070000e-34 158.0
33 TraesCS1B01G133500 chr2B 96.751 277 9 0 2499 2775 216470125 216469849 3.910000e-126 462.0
34 TraesCS1B01G133500 chr4B 95.745 282 12 0 2495 2776 467910178 467910459 6.540000e-124 455.0
35 TraesCS1B01G133500 chr4B 96.043 278 11 0 2497 2774 307461988 307462265 2.350000e-123 453.0
36 TraesCS1B01G133500 chr3B 96.071 280 10 1 2496 2774 739572500 739572221 6.540000e-124 455.0
37 TraesCS1B01G133500 chr3B 100.000 29 0 0 5503 5531 760593378 760593350 3.000000e-03 54.7
38 TraesCS1B01G133500 chr5B 96.043 278 11 0 2497 2774 332324680 332324957 2.350000e-123 453.0
39 TraesCS1B01G133500 chr5B 80.100 201 26 8 2139 2329 174866188 174865992 2.690000e-28 137.0
40 TraesCS1B01G133500 chr5B 77.848 158 19 6 1881 2034 705966907 705967052 3.560000e-12 84.2
41 TraesCS1B01G133500 chr5B 100.000 29 0 0 5503 5531 391917287 391917315 3.000000e-03 54.7
42 TraesCS1B01G133500 chr2A 91.429 140 11 1 5244 5382 141506331 141506470 2.040000e-44 191.0
43 TraesCS1B01G133500 chr2A 92.537 67 4 1 277 342 38431750 38431816 1.640000e-15 95.3
44 TraesCS1B01G133500 chr3A 88.079 151 17 1 5237 5386 401026591 401026741 1.590000e-40 178.0
45 TraesCS1B01G133500 chr3A 100.000 29 0 0 5503 5531 36875034 36875006 3.000000e-03 54.7
46 TraesCS1B01G133500 chr4A 88.514 148 14 2 5237 5382 636663067 636663213 5.700000e-40 176.0
47 TraesCS1B01G133500 chr2D 85.811 148 19 2 5237 5382 58651708 58651855 7.430000e-34 156.0
48 TraesCS1B01G133500 chrUn 81.959 194 20 8 2147 2329 67781882 67781693 3.460000e-32 150.0
49 TraesCS1B01G133500 chr5D 100.000 31 0 0 5500 5530 382491776 382491746 2.160000e-04 58.4
50 TraesCS1B01G133500 chr7D 100.000 28 0 0 5503 5530 467923078 467923051 1.000000e-02 52.8


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G133500 chr1B 168969498 168975037 5539 False 10194.000000 10194 100.000000 1 5540 1 chr1B.!!$F2 5539
1 TraesCS1B01G133500 chr1B 168987819 168989343 1524 False 578.500000 1459 96.767250 1 2489 4 chr1B.!!$F5 2488
2 TraesCS1B01G133500 chr1A 116693610 116698652 5042 False 714.428571 3007 89.047857 256 5498 7 chr1A.!!$F1 5242
3 TraesCS1B01G133500 chr1D 110731016 110735916 4900 False 633.142857 1399 91.266429 1 4837 7 chr1D.!!$F1 4836

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
354 355 0.107017 ATCCAATGAACAGCGAGGGG 60.107 55.0 0.00 0.00 0.00 4.79 F
733 1022 0.179132 GCATGCATCCATCGCAACAA 60.179 50.0 14.21 0.00 43.84 2.83 F
1789 2798 0.390472 CTGGTCGTTGAGCTCCTTCC 60.390 60.0 12.15 7.35 0.00 3.46 F
2286 3295 0.036732 TGCTGGCTAAGTGGTCCTTG 59.963 55.0 0.00 0.00 34.46 3.61 F
2288 3297 0.326264 CTGGCTAAGTGGTCCTTGCT 59.674 55.0 0.00 0.00 34.46 3.91 F
3439 5589 0.249197 GCGTCGTATCAACTACCCCC 60.249 60.0 0.00 0.00 0.00 5.40 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2267 3276 0.036732 CAAGGACCACTTAGCCAGCA 59.963 55.000 0.00 0.0 37.29 4.41 R
2269 3278 0.326264 AGCAAGGACCACTTAGCCAG 59.674 55.000 0.00 0.0 37.29 4.85 R
3076 5221 0.183014 TACAAAGTTTGGTGGGGCGA 59.817 50.000 19.45 0.0 34.12 5.54 R
3355 5505 1.153667 CTGGAAGAGCTGCGAGGAC 60.154 63.158 0.00 0.0 34.07 3.85 R
3694 5846 1.224592 GTGGATGTCCTTGCCGGAT 59.775 57.895 5.05 0.0 45.44 4.18 R
4935 7228 0.595588 TTGTTGCGCACATACCAAGG 59.404 50.000 11.12 0.0 34.43 3.61 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.