Multiple sequence alignment - TraesCS1B01G126400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G126400 chr1B 100.000 2549 0 0 1 2549 154580028 154582576 0 4708
1 TraesCS1B01G126400 chr1B 94.690 565 30 0 1 565 216475835 216476399 0 878
2 TraesCS1B01G126400 chr2B 96.585 1991 64 3 563 2549 384810185 384808195 0 3297
3 TraesCS1B01G126400 chr2B 92.919 1949 113 15 565 2494 565228144 565226202 0 2811
4 TraesCS1B01G126400 chr2B 96.371 1543 52 4 567 2107 543889470 543887930 0 2536
5 TraesCS1B01G126400 chr2B 96.253 1548 56 2 563 2108 596962065 596963612 0 2536
6 TraesCS1B01G126400 chr2B 92.371 852 51 9 1706 2549 710553143 710552298 0 1201
7 TraesCS1B01G126400 chr7B 96.259 1978 70 3 566 2542 670173344 670171370 0 3240
8 TraesCS1B01G126400 chr7B 96.966 1582 42 4 970 2549 256815348 256813771 0 2651
9 TraesCS1B01G126400 chr7B 92.723 852 45 8 1706 2549 523398516 523397674 0 1214
10 TraesCS1B01G126400 chr7B 92.781 845 45 9 1706 2542 523523738 523522902 0 1208
11 TraesCS1B01G126400 chr7B 97.615 629 12 2 1922 2549 621925718 621926344 0 1075
12 TraesCS1B01G126400 chr7B 96.661 629 19 2 1922 2549 708941718 708941091 0 1044
13 TraesCS1B01G126400 chr7B 96.497 628 20 2 1922 2549 12493143 12492518 0 1037
14 TraesCS1B01G126400 chr7B 96.502 629 19 2 1922 2549 27419926 27419300 0 1037
15 TraesCS1B01G126400 chr7B 94.690 565 30 0 1 565 220839509 220840073 0 878
16 TraesCS1B01G126400 chr5B 96.565 1543 51 2 567 2108 269389473 269391014 0 2555
17 TraesCS1B01G126400 chr5B 96.507 1546 51 3 564 2108 317969012 317970555 0 2553
18 TraesCS1B01G126400 chr5B 96.318 1548 54 3 563 2108 446193259 446191713 0 2540
19 TraesCS1B01G126400 chr5B 92.865 855 44 9 1706 2549 508123189 508122341 0 1225
20 TraesCS1B01G126400 chr5B 92.028 853 54 7 1706 2549 680229279 680228432 0 1186
21 TraesCS1B01G126400 chr5B 91.873 849 51 9 1706 2547 452112036 452111199 0 1170
22 TraesCS1B01G126400 chr5B 94.346 566 31 1 1 566 230283056 230283620 0 867
23 TraesCS1B01G126400 chr3B 93.863 1108 38 14 1457 2549 687026254 687027346 0 1642
24 TraesCS1B01G126400 chr3B 92.732 853 49 6 1706 2549 548473360 548474208 0 1219
25 TraesCS1B01G126400 chr6B 93.083 853 44 8 1706 2549 59432328 59431482 0 1234
26 TraesCS1B01G126400 chr1D 95.583 566 25 0 1 566 207133949 207133384 0 907
27 TraesCS1B01G126400 chrUn 94.700 566 29 1 1 566 242408745 242409309 0 878
28 TraesCS1B01G126400 chrUn 94.523 566 29 2 1 566 85408379 85407816 0 872
29 TraesCS1B01G126400 chr2D 94.346 566 31 1 1 566 187486490 187487054 0 867
30 TraesCS1B01G126400 chr4A 94.170 566 33 0 1 566 284729251 284728686 0 863
31 TraesCS1B01G126400 chr2A 94.180 567 32 1 1 566 313810764 313810198 0 863


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G126400 chr1B 154580028 154582576 2548 False 4708 4708 100.000 1 2549 1 chr1B.!!$F1 2548
1 TraesCS1B01G126400 chr1B 216475835 216476399 564 False 878 878 94.690 1 565 1 chr1B.!!$F2 564
2 TraesCS1B01G126400 chr2B 384808195 384810185 1990 True 3297 3297 96.585 563 2549 1 chr2B.!!$R1 1986
3 TraesCS1B01G126400 chr2B 565226202 565228144 1942 True 2811 2811 92.919 565 2494 1 chr2B.!!$R3 1929
4 TraesCS1B01G126400 chr2B 543887930 543889470 1540 True 2536 2536 96.371 567 2107 1 chr2B.!!$R2 1540
5 TraesCS1B01G126400 chr2B 596962065 596963612 1547 False 2536 2536 96.253 563 2108 1 chr2B.!!$F1 1545
6 TraesCS1B01G126400 chr2B 710552298 710553143 845 True 1201 1201 92.371 1706 2549 1 chr2B.!!$R4 843
7 TraesCS1B01G126400 chr7B 670171370 670173344 1974 True 3240 3240 96.259 566 2542 1 chr7B.!!$R6 1976
8 TraesCS1B01G126400 chr7B 256813771 256815348 1577 True 2651 2651 96.966 970 2549 1 chr7B.!!$R3 1579
9 TraesCS1B01G126400 chr7B 523397674 523398516 842 True 1214 1214 92.723 1706 2549 1 chr7B.!!$R4 843
10 TraesCS1B01G126400 chr7B 523522902 523523738 836 True 1208 1208 92.781 1706 2542 1 chr7B.!!$R5 836
11 TraesCS1B01G126400 chr7B 621925718 621926344 626 False 1075 1075 97.615 1922 2549 1 chr7B.!!$F2 627
12 TraesCS1B01G126400 chr7B 708941091 708941718 627 True 1044 1044 96.661 1922 2549 1 chr7B.!!$R7 627
13 TraesCS1B01G126400 chr7B 12492518 12493143 625 True 1037 1037 96.497 1922 2549 1 chr7B.!!$R1 627
14 TraesCS1B01G126400 chr7B 27419300 27419926 626 True 1037 1037 96.502 1922 2549 1 chr7B.!!$R2 627
15 TraesCS1B01G126400 chr7B 220839509 220840073 564 False 878 878 94.690 1 565 1 chr7B.!!$F1 564
16 TraesCS1B01G126400 chr5B 269389473 269391014 1541 False 2555 2555 96.565 567 2108 1 chr5B.!!$F2 1541
17 TraesCS1B01G126400 chr5B 317969012 317970555 1543 False 2553 2553 96.507 564 2108 1 chr5B.!!$F3 1544
18 TraesCS1B01G126400 chr5B 446191713 446193259 1546 True 2540 2540 96.318 563 2108 1 chr5B.!!$R1 1545
19 TraesCS1B01G126400 chr5B 508122341 508123189 848 True 1225 1225 92.865 1706 2549 1 chr5B.!!$R3 843
20 TraesCS1B01G126400 chr5B 680228432 680229279 847 True 1186 1186 92.028 1706 2549 1 chr5B.!!$R4 843
21 TraesCS1B01G126400 chr5B 452111199 452112036 837 True 1170 1170 91.873 1706 2547 1 chr5B.!!$R2 841
22 TraesCS1B01G126400 chr5B 230283056 230283620 564 False 867 867 94.346 1 566 1 chr5B.!!$F1 565
23 TraesCS1B01G126400 chr3B 687026254 687027346 1092 False 1642 1642 93.863 1457 2549 1 chr3B.!!$F2 1092
24 TraesCS1B01G126400 chr3B 548473360 548474208 848 False 1219 1219 92.732 1706 2549 1 chr3B.!!$F1 843
25 TraesCS1B01G126400 chr6B 59431482 59432328 846 True 1234 1234 93.083 1706 2549 1 chr6B.!!$R1 843
26 TraesCS1B01G126400 chr1D 207133384 207133949 565 True 907 907 95.583 1 566 1 chr1D.!!$R1 565
27 TraesCS1B01G126400 chrUn 242408745 242409309 564 False 878 878 94.700 1 566 1 chrUn.!!$F1 565
28 TraesCS1B01G126400 chrUn 85407816 85408379 563 True 872 872 94.523 1 566 1 chrUn.!!$R1 565
29 TraesCS1B01G126400 chr2D 187486490 187487054 564 False 867 867 94.346 1 566 1 chr2D.!!$F1 565
30 TraesCS1B01G126400 chr4A 284728686 284729251 565 True 863 863 94.170 1 566 1 chr4A.!!$R1 565
31 TraesCS1B01G126400 chr2A 313810198 313810764 566 True 863 863 94.180 1 566 1 chr2A.!!$R1 565

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
633 635 1.820519 GCCCTCAGATGCAAATTGTGA 59.179 47.619 0.0 0.0 0.0 3.58 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2324 2361 1.003051 GGGGGTGAGAAGCCCTCTA 59.997 63.158 12.46 0.0 43.38 2.43 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
82 83 6.207691 AGAAAACTACACACTTGTTGCAAT 57.792 33.333 0.59 0.00 37.15 3.56
418 420 4.836125 AACAAGCCATTCATATAAGCCG 57.164 40.909 0.00 0.00 0.00 5.52
427 429 6.738453 GCCATTCATATAAGCCGAATTTGGTT 60.738 38.462 13.49 4.23 0.00 3.67
633 635 1.820519 GCCCTCAGATGCAAATTGTGA 59.179 47.619 0.00 0.00 0.00 3.58
768 770 5.870978 GCCAATTTTATTCAGACTGTTGCAT 59.129 36.000 1.59 0.00 0.00 3.96
771 773 5.710513 TTTTATTCAGACTGTTGCATGCT 57.289 34.783 20.33 0.00 0.00 3.79
897 899 3.749064 GACCACGGCGAGAGAGCA 61.749 66.667 16.62 0.00 39.27 4.26
935 937 2.601194 GAAGCTAGCTGTGGAGGGCC 62.601 65.000 20.16 0.00 0.00 5.80
965 967 3.775654 GCTAGCTGTGGAGGGCGT 61.776 66.667 7.70 0.00 0.00 5.68
1071 1073 2.306805 TGTGGAGATGCCTGTCTTCATT 59.693 45.455 0.00 0.00 36.19 2.57
1110 1112 1.366854 GCGTTGATCGGAGGGTTTCC 61.367 60.000 0.00 0.00 43.04 3.13
1172 1174 2.223971 GCGAGAATGGGGTAAGAATCGA 60.224 50.000 0.00 0.00 0.00 3.59
1312 1314 2.556144 ACTGCAAGAAGAGCATGACA 57.444 45.000 0.00 0.00 41.82 3.58
1919 1935 9.474313 TTTAAGGGCATTACATTGAGTAGAAAT 57.526 29.630 0.00 0.00 33.43 2.17
2015 2034 3.745163 CGTGGGTTAGTTGTGTTTAGGGT 60.745 47.826 0.00 0.00 0.00 4.34
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
82 83 1.306997 TTGGCCCCAACCAACCAAA 60.307 52.632 0.00 0.0 44.80 3.28
378 380 4.614475 TGTTATGCCAATGGGTTTATCCA 58.386 39.130 0.00 0.0 41.60 3.41
418 420 6.908284 GGAAAACCGCTTTTAAAACCAAATTC 59.092 34.615 0.00 0.0 29.21 2.17
427 429 4.367386 TGAACGGAAAACCGCTTTTAAA 57.633 36.364 8.59 0.0 36.58 1.52
433 435 1.156736 CTGATGAACGGAAAACCGCT 58.843 50.000 8.59 0.0 36.58 5.52
444 446 2.223203 CGCATCCAAGAAGCTGATGAAC 60.223 50.000 13.59 0.0 38.49 3.18
452 454 4.558538 ATCAAATACGCATCCAAGAAGC 57.441 40.909 0.00 0.0 0.00 3.86
633 635 1.065418 CGGACTAGGGGCAAAACTGAT 60.065 52.381 0.00 0.0 0.00 2.90
771 773 4.659172 CTGGGTCCCGCAAGCCAA 62.659 66.667 2.65 0.0 45.65 4.52
789 791 2.881513 CTCTATGCTCAACGGCTCTCTA 59.118 50.000 0.00 0.0 0.00 2.43
841 843 4.681978 GTGGTCACCGCCGCTCTT 62.682 66.667 0.00 0.0 36.19 2.85
935 937 4.530857 CTAGCTTCCCACCGCCGG 62.531 72.222 0.00 0.0 0.00 6.13
965 967 2.192979 GGGATCTCAATGCCGCCA 59.807 61.111 0.00 0.0 33.27 5.69
972 974 2.212327 AGCCGAACGGGATCTCAAT 58.788 52.632 15.01 0.0 38.47 2.57
1110 1112 1.597027 GTGGTTCCTCGGTGTGTGG 60.597 63.158 0.00 0.0 0.00 4.17
1172 1174 1.344114 ACGAAAATGGTGCAATTGCCT 59.656 42.857 26.94 7.0 41.18 4.75
1312 1314 4.582760 CAGCATGCGCAACCATTT 57.417 50.000 17.11 0.0 42.27 2.32
2004 2023 1.169661 CCAGCGCAACCCTAAACACA 61.170 55.000 11.47 0.0 0.00 3.72
2324 2361 1.003051 GGGGGTGAGAAGCCCTCTA 59.997 63.158 12.46 0.0 43.38 2.43


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.