Multiple sequence alignment - TraesCS1B01G117600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G117600 chr1B 100.000 2456 0 0 1 2456 137558984 137561439 0.000000e+00 4536
1 TraesCS1B01G117600 chr1B 99.268 820 5 1 1638 2456 137567666 137568485 0.000000e+00 1480
2 TraesCS1B01G117600 chr1B 98.000 300 6 0 1338 1637 582552823 582552524 2.800000e-144 521
3 TraesCS1B01G117600 chr5A 98.779 1638 16 3 3 1637 445431446 445433082 0.000000e+00 2911
4 TraesCS1B01G117600 chr1A 98.598 1641 19 3 1 1637 547921687 547923327 0.000000e+00 2900
5 TraesCS1B01G117600 chr1A 94.952 832 31 9 1630 2456 552061263 552062088 0.000000e+00 1293
6 TraesCS1B01G117600 chr4A 98.416 1641 22 3 1 1637 613537751 613539391 0.000000e+00 2883
7 TraesCS1B01G117600 chr7A 98.050 1641 28 3 1 1637 657730682 657729042 0.000000e+00 2850
8 TraesCS1B01G117600 chr7B 96.229 1644 53 5 1 1637 744746853 744748494 0.000000e+00 2684
9 TraesCS1B01G117600 chr3A 98.293 1289 19 2 1 1286 688953830 688955118 0.000000e+00 2255
10 TraesCS1B01G117600 chr3A 95.737 821 29 6 1638 2456 689483440 689484256 0.000000e+00 1317
11 TraesCS1B01G117600 chr3A 98.599 357 5 0 1281 1637 688955373 688955729 1.240000e-177 632
12 TraesCS1B01G117600 chr2B 96.837 822 22 4 1636 2456 159460893 159460075 0.000000e+00 1371
13 TraesCS1B01G117600 chr2B 95.869 823 27 5 1638 2456 159453859 159453040 0.000000e+00 1325
14 TraesCS1B01G117600 chr2B 95.267 824 30 9 1637 2456 688444985 688445803 0.000000e+00 1297
15 TraesCS1B01G117600 chr3B 96.829 820 21 5 1638 2456 455795207 455794392 0.000000e+00 1365
16 TraesCS1B01G117600 chr3B 96.350 822 25 5 1636 2456 455802252 455801435 0.000000e+00 1347
17 TraesCS1B01G117600 chr5B 95.066 831 29 10 1632 2456 26521498 26520674 0.000000e+00 1297
18 TraesCS1B01G117600 chr6B 98.892 632 6 1 1007 1637 249445522 249446153 0.000000e+00 1127
19 TraesCS1B01G117600 chr3D 97.872 329 7 0 1309 1637 36543068 36542740 9.850000e-159 569
20 TraesCS1B01G117600 chr3D 98.958 96 1 0 1140 1235 36543162 36543067 3.250000e-39 172


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G117600 chr1B 137558984 137561439 2455 False 4536.0 4536 100.000 1 2456 1 chr1B.!!$F1 2455
1 TraesCS1B01G117600 chr1B 137567666 137568485 819 False 1480.0 1480 99.268 1638 2456 1 chr1B.!!$F2 818
2 TraesCS1B01G117600 chr5A 445431446 445433082 1636 False 2911.0 2911 98.779 3 1637 1 chr5A.!!$F1 1634
3 TraesCS1B01G117600 chr1A 547921687 547923327 1640 False 2900.0 2900 98.598 1 1637 1 chr1A.!!$F1 1636
4 TraesCS1B01G117600 chr1A 552061263 552062088 825 False 1293.0 1293 94.952 1630 2456 1 chr1A.!!$F2 826
5 TraesCS1B01G117600 chr4A 613537751 613539391 1640 False 2883.0 2883 98.416 1 1637 1 chr4A.!!$F1 1636
6 TraesCS1B01G117600 chr7A 657729042 657730682 1640 True 2850.0 2850 98.050 1 1637 1 chr7A.!!$R1 1636
7 TraesCS1B01G117600 chr7B 744746853 744748494 1641 False 2684.0 2684 96.229 1 1637 1 chr7B.!!$F1 1636
8 TraesCS1B01G117600 chr3A 688953830 688955729 1899 False 1443.5 2255 98.446 1 1637 2 chr3A.!!$F2 1636
9 TraesCS1B01G117600 chr3A 689483440 689484256 816 False 1317.0 1317 95.737 1638 2456 1 chr3A.!!$F1 818
10 TraesCS1B01G117600 chr2B 159460075 159460893 818 True 1371.0 1371 96.837 1636 2456 1 chr2B.!!$R2 820
11 TraesCS1B01G117600 chr2B 159453040 159453859 819 True 1325.0 1325 95.869 1638 2456 1 chr2B.!!$R1 818
12 TraesCS1B01G117600 chr2B 688444985 688445803 818 False 1297.0 1297 95.267 1637 2456 1 chr2B.!!$F1 819
13 TraesCS1B01G117600 chr3B 455794392 455795207 815 True 1365.0 1365 96.829 1638 2456 1 chr3B.!!$R1 818
14 TraesCS1B01G117600 chr3B 455801435 455802252 817 True 1347.0 1347 96.350 1636 2456 1 chr3B.!!$R2 820
15 TraesCS1B01G117600 chr5B 26520674 26521498 824 True 1297.0 1297 95.066 1632 2456 1 chr5B.!!$R1 824
16 TraesCS1B01G117600 chr6B 249445522 249446153 631 False 1127.0 1127 98.892 1007 1637 1 chr6B.!!$F1 630

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
818 821 1.072331 AGGTGAGAGTTGGCGTTCATT 59.928 47.619 0.0 0.0 0.0 2.57 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2359 2639 2.29045 GGGACAAGTTTCGGGGTTATCA 60.29 50.0 0.0 0.0 0.0 2.15 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
92 93 6.882610 TGAAAAGCTGTGTTCTGTTATCAT 57.117 33.333 0.00 0.0 0.0 2.45
326 327 2.224450 ACCTTACACAGTACAGGCCAAC 60.224 50.000 5.01 0.0 0.0 3.77
408 409 5.070847 ACCAGTACTGCATCATATCATCACA 59.929 40.000 17.86 0.0 0.0 3.58
818 821 1.072331 AGGTGAGAGTTGGCGTTCATT 59.928 47.619 0.00 0.0 0.0 2.57
1435 1699 4.012374 AGGTTGCTTACATCACCAGATTG 58.988 43.478 0.00 0.0 30.2 2.67
1590 1854 2.915869 AGAGGGTTGGTGATGGTTCTA 58.084 47.619 0.00 0.0 0.0 2.10
2359 2639 1.197812 GGTGGTCCCGGTACAATACT 58.802 55.000 0.00 0.0 0.0 2.12
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
92 93 7.192852 AGAGCTCTTTCAATCTCCTCATTTA 57.807 36.000 11.45 0.00 0.00 1.40
326 327 2.688507 AGAGCACGTTACACAATGAGG 58.311 47.619 0.00 0.00 0.00 3.86
408 409 4.819630 TGGATAAACGCTGTTTGTTCTTCT 59.180 37.500 14.23 0.00 0.00 2.85
818 821 2.683916 GGTGTGAGACCCATGGAGA 58.316 57.895 15.22 0.00 39.10 3.71
1435 1699 5.216648 CCTTTAAGACTCTAGCGCATAGAC 58.783 45.833 11.47 4.03 35.50 2.59
1590 1854 2.587060 TCCTCCCATGGGTGAATAGT 57.413 50.000 30.51 0.00 36.47 2.12
1668 1934 6.373005 TGATCTTGGTGAAATGAGTAGGAA 57.627 37.500 0.00 0.00 0.00 3.36
2359 2639 2.290450 GGGACAAGTTTCGGGGTTATCA 60.290 50.000 0.00 0.00 0.00 2.15


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.