Multiple sequence alignment - TraesCS1B01G114000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G114000 chr1B 100.000 2663 0 0 1 2663 133124976 133122314 0.000000e+00 4918.0
1 TraesCS1B01G114000 chr1B 95.831 1703 33 14 967 2663 133111350 133109680 0.000000e+00 2717.0
2 TraesCS1B01G114000 chr1B 92.041 1872 86 31 812 2663 426482099 426480271 0.000000e+00 2573.0
3 TraesCS1B01G114000 chr1B 97.975 889 17 1 1700 2587 426496083 426495195 0.000000e+00 1541.0
4 TraesCS1B01G114000 chr7B 93.084 2169 65 18 373 2508 589919489 589921605 0.000000e+00 3096.0
5 TraesCS1B01G114000 chr7B 94.164 2039 51 14 629 2637 588878456 588876456 0.000000e+00 3044.0
6 TraesCS1B01G114000 chr7B 95.136 1912 62 10 775 2663 589735254 589737157 0.000000e+00 2987.0
7 TraesCS1B01G114000 chr7B 94.463 1824 42 23 812 2613 589696285 589694499 0.000000e+00 2754.0
8 TraesCS1B01G114000 chr7B 97.228 505 12 1 1 505 588878997 588878495 0.000000e+00 854.0
9 TraesCS1B01G114000 chr7B 79.095 928 116 33 818 1702 537825684 537824792 3.850000e-158 568.0
10 TraesCS1B01G114000 chr7B 87.302 189 15 6 89 270 537825930 537825744 9.660000e-50 207.0
11 TraesCS1B01G114000 chr7B 89.308 159 6 2 642 800 498300240 498300093 3.500000e-44 189.0
12 TraesCS1B01G114000 chr7B 100.000 39 0 0 766 804 589735140 589735178 3.680000e-09 73.1
13 TraesCS1B01G114000 chr7B 100.000 28 0 0 373 400 589934822 589934849 5.000000e-03 52.8
14 TraesCS1B01G114000 chr7A 93.011 1860 96 18 812 2663 628385905 628384072 0.000000e+00 2684.0
15 TraesCS1B01G114000 chr7A 94.651 1720 84 6 855 2573 627008678 627006966 0.000000e+00 2660.0
16 TraesCS1B01G114000 chr7A 98.447 837 13 0 1706 2542 627231654 627230818 0.000000e+00 1474.0
17 TraesCS1B01G114000 chr7A 89.583 144 8 5 130 273 628386313 628386177 2.720000e-40 176.0
18 TraesCS1B01G114000 chr7A 96.970 99 2 1 362 460 627234228 627234131 5.900000e-37 165.0
19 TraesCS1B01G114000 chr7A 98.750 80 1 0 730 809 628386020 628385941 2.760000e-30 143.0
20 TraesCS1B01G114000 chr7A 82.550 149 16 6 132 270 580504815 580504667 3.600000e-24 122.0
21 TraesCS1B01G114000 chr7A 85.897 78 2 1 608 676 628386099 628386022 1.020000e-09 75.0
22 TraesCS1B01G114000 chr7A 100.000 35 0 0 775 809 627008772 627008738 6.150000e-07 65.8
23 TraesCS1B01G114000 chr7A 100.000 33 0 0 699 731 627232648 627232616 7.960000e-06 62.1
24 TraesCS1B01G114000 chr5D 97.526 970 18 1 1700 2663 289354400 289353431 0.000000e+00 1653.0
25 TraesCS1B01G114000 chr5D 97.422 931 18 3 1700 2624 289420207 289419277 0.000000e+00 1581.0
26 TraesCS1B01G114000 chr5D 92.582 1065 51 15 649 1702 289355493 289354446 0.000000e+00 1504.0
27 TraesCS1B01G114000 chr5D 93.567 855 44 6 857 1702 289421105 289420253 0.000000e+00 1264.0
28 TraesCS1B01G114000 chr5D 91.650 515 25 6 1 505 289356139 289355633 0.000000e+00 697.0
29 TraesCS1B01G114000 chr5D 90.722 97 4 2 507 598 289355587 289355491 1.000000e-24 124.0
30 TraesCS1B01G114000 chr5D 97.619 42 1 0 475 516 29906376 29906417 3.680000e-09 73.1
31 TraesCS1B01G114000 chr6A 96.670 931 24 4 1700 2624 107265288 107266217 0.000000e+00 1541.0
32 TraesCS1B01G114000 chr6A 86.974 1021 64 19 718 1702 107264255 107265242 0.000000e+00 1085.0
33 TraesCS1B01G114000 chr6A 100.000 32 0 0 363 394 107264075 107264106 2.860000e-05 60.2
34 TraesCS1B01G114000 chr2A 92.831 823 38 5 1767 2587 85809960 85809157 0.000000e+00 1173.0
35 TraesCS1B01G114000 chr2A 98.214 56 0 1 2601 2656 86060079 86060025 2.180000e-16 97.1
36 TraesCS1B01G114000 chr7D 88.662 882 79 12 818 1694 545650456 545651321 0.000000e+00 1055.0
37 TraesCS1B01G114000 chr7D 84.783 184 19 5 92 266 509580053 509579870 2.720000e-40 176.0
38 TraesCS1B01G114000 chr7D 100.000 32 0 0 306 337 509599036 509599005 2.860000e-05 60.2
39 TraesCS1B01G114000 chr7D 96.875 32 0 1 153 183 545254722 545254753 5.000000e-03 52.8
40 TraesCS1B01G114000 chr2B 87.624 905 65 19 759 1653 135512529 135513396 0.000000e+00 1007.0
41 TraesCS1B01G114000 chr2B 88.031 259 18 7 818 1066 127790184 127789929 7.210000e-76 294.0
42 TraesCS1B01G114000 chr2B 88.535 157 13 4 304 460 135512325 135512476 4.530000e-43 185.0
43 TraesCS1B01G114000 chr2B 96.825 63 1 1 2601 2663 137347428 137347367 1.300000e-18 104.0
44 TraesCS1B01G114000 chr2B 90.909 55 5 0 679 733 135512479 135512533 1.020000e-09 75.0
45 TraesCS1B01G114000 chr2D 96.825 63 1 1 2601 2663 85249074 85249013 1.300000e-18 104.0
46 TraesCS1B01G114000 chr4A 96.429 56 1 1 2601 2656 349804633 349804579 1.020000e-14 91.6


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G114000 chr1B 133122314 133124976 2662 True 4918.000000 4918 100.000000 1 2663 1 chr1B.!!$R2 2662
1 TraesCS1B01G114000 chr1B 133109680 133111350 1670 True 2717.000000 2717 95.831000 967 2663 1 chr1B.!!$R1 1696
2 TraesCS1B01G114000 chr1B 426480271 426482099 1828 True 2573.000000 2573 92.041000 812 2663 1 chr1B.!!$R3 1851
3 TraesCS1B01G114000 chr1B 426495195 426496083 888 True 1541.000000 1541 97.975000 1700 2587 1 chr1B.!!$R4 887
4 TraesCS1B01G114000 chr7B 589919489 589921605 2116 False 3096.000000 3096 93.084000 373 2508 1 chr7B.!!$F1 2135
5 TraesCS1B01G114000 chr7B 589694499 589696285 1786 True 2754.000000 2754 94.463000 812 2613 1 chr7B.!!$R2 1801
6 TraesCS1B01G114000 chr7B 588876456 588878997 2541 True 1949.000000 3044 95.696000 1 2637 2 chr7B.!!$R4 2636
7 TraesCS1B01G114000 chr7B 589735140 589737157 2017 False 1530.050000 2987 97.568000 766 2663 2 chr7B.!!$F3 1897
8 TraesCS1B01G114000 chr7B 537824792 537825930 1138 True 387.500000 568 83.198500 89 1702 2 chr7B.!!$R3 1613
9 TraesCS1B01G114000 chr7A 627006966 627008772 1806 True 1362.900000 2660 97.325500 775 2573 2 chr7A.!!$R2 1798
10 TraesCS1B01G114000 chr7A 628384072 628386313 2241 True 769.500000 2684 91.810250 130 2663 4 chr7A.!!$R4 2533
11 TraesCS1B01G114000 chr7A 627230818 627234228 3410 True 567.033333 1474 98.472333 362 2542 3 chr7A.!!$R3 2180
12 TraesCS1B01G114000 chr5D 289419277 289421105 1828 True 1422.500000 1581 95.494500 857 2624 2 chr5D.!!$R2 1767
13 TraesCS1B01G114000 chr5D 289353431 289356139 2708 True 994.500000 1653 93.120000 1 2663 4 chr5D.!!$R1 2662
14 TraesCS1B01G114000 chr6A 107264075 107266217 2142 False 895.400000 1541 94.548000 363 2624 3 chr6A.!!$F1 2261
15 TraesCS1B01G114000 chr2A 85809157 85809960 803 True 1173.000000 1173 92.831000 1767 2587 1 chr2A.!!$R1 820
16 TraesCS1B01G114000 chr7D 545650456 545651321 865 False 1055.000000 1055 88.662000 818 1694 1 chr7D.!!$F2 876
17 TraesCS1B01G114000 chr2B 135512325 135513396 1071 False 422.333333 1007 89.022667 304 1653 3 chr2B.!!$F1 1349

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
99 110 7.280205 GTCCTTTTATACGGACATGAGAACAAT 59.72 37.037 0.0 0.0 46.98 2.71 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1668 3428 0.614697 TCCTCTGCTTCGATCACCCA 60.615 55.0 0.0 0.0 0.0 4.51 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
84 95 7.916552 ACAGTTATTCGCATGTCCTTTTATAC 58.083 34.615 0.00 0.0 0.00 1.47
99 110 7.280205 GTCCTTTTATACGGACATGAGAACAAT 59.720 37.037 0.00 0.0 46.98 2.71
1668 3428 0.392998 AAATCCACGGATGAGCGCTT 60.393 50.000 13.26 0.0 34.70 4.68
1950 3787 7.494211 TGTTAAGATGTGTACGGCATAGTTAT 58.506 34.615 3.19 0.0 0.00 1.89
2592 4438 2.553602 GAGTGGTGATGCACATGTTTGA 59.446 45.455 0.00 0.0 35.86 2.69
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
84 95 3.670055 GCAAACAATTGTTCTCATGTCCG 59.330 43.478 23.47 5.96 38.85 4.79
99 110 6.402222 AGTATCAGTTTTGGTTTGCAAACAA 58.598 32.000 35.95 27.24 40.63 2.83
349 367 6.724694 GCATGGTGCATTCAGATTTAAAAA 57.275 33.333 0.00 0.00 44.26 1.94
1668 3428 0.614697 TCCTCTGCTTCGATCACCCA 60.615 55.000 0.00 0.00 0.00 4.51
2346 4185 5.421056 TGATAGTCGGTACATCAAGGACTTT 59.579 40.000 0.00 0.00 38.74 2.66
2413 4252 1.536766 TGCTCTGCAAAATTCAGACCG 59.463 47.619 0.00 0.00 35.81 4.79
2592 4438 9.832445 TCACATTCTTGACTAGTTACTCTTTTT 57.168 29.630 0.00 0.00 0.00 1.94


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.