Multiple sequence alignment - TraesCS1B01G110900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G110900 chr1B 100.000 2468 0 0 1 2468 126921401 126923868 0.000000e+00 4558
1 TraesCS1B01G110900 chr2B 96.076 2472 87 9 1 2468 109886718 109889183 0.000000e+00 4019
2 TraesCS1B01G110900 chr2B 96.946 2030 62 0 439 2468 614643420 614645449 0.000000e+00 3406
3 TraesCS1B01G110900 chr2B 96.961 362 7 3 1 359 614642687 614643047 2.710000e-169 604
4 TraesCS1B01G110900 chr5B 95.546 2492 72 8 1 2468 525550055 525547579 0.000000e+00 3951
5 TraesCS1B01G110900 chr1D 94.614 1634 79 7 1 1626 288858311 288859943 0.000000e+00 2521
6 TraesCS1B01G110900 chr1D 97.236 832 23 0 1637 2468 288860317 288861148 0.000000e+00 1410
7 TraesCS1B01G110900 chr2A 95.235 1574 69 5 1 1570 494101293 494099722 0.000000e+00 2486
8 TraesCS1B01G110900 chr2A 95.038 1572 70 6 1 1567 354528927 354530495 0.000000e+00 2464
9 TraesCS1B01G110900 chr2A 96.154 832 26 1 1637 2468 354530501 354531326 0.000000e+00 1354
10 TraesCS1B01G110900 chr2A 94.894 235 11 1 1637 1871 494099719 494099486 1.390000e-97 366
11 TraesCS1B01G110900 chr7D 93.272 1635 95 9 1 1629 61524212 61522587 0.000000e+00 2396
12 TraesCS1B01G110900 chr7D 96.995 832 25 0 1637 2468 61522216 61521385 0.000000e+00 1399
13 TraesCS1B01G110900 chr7A 94.282 1574 77 10 1 1567 320507537 320509104 0.000000e+00 2396
14 TraesCS1B01G110900 chr7A 95.673 832 36 0 1637 2468 320509110 320509941 0.000000e+00 1338
15 TraesCS1B01G110900 chr1A 92.762 1644 97 14 1 1626 408631022 408632661 0.000000e+00 2357
16 TraesCS1B01G110900 chr4D 96.274 832 31 0 1637 2468 382847075 382846244 0.000000e+00 1365
17 TraesCS1B01G110900 chr6D 93.314 703 37 3 1775 2468 93876313 93877014 0.000000e+00 1029
18 TraesCS1B01G110900 chr3A 93.282 387 20 4 1 381 34899592 34899206 1.280000e-157 566


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G110900 chr1B 126921401 126923868 2467 False 4558.0 4558 100.0000 1 2468 1 chr1B.!!$F1 2467
1 TraesCS1B01G110900 chr2B 109886718 109889183 2465 False 4019.0 4019 96.0760 1 2468 1 chr2B.!!$F1 2467
2 TraesCS1B01G110900 chr2B 614642687 614645449 2762 False 2005.0 3406 96.9535 1 2468 2 chr2B.!!$F2 2467
3 TraesCS1B01G110900 chr5B 525547579 525550055 2476 True 3951.0 3951 95.5460 1 2468 1 chr5B.!!$R1 2467
4 TraesCS1B01G110900 chr1D 288858311 288861148 2837 False 1965.5 2521 95.9250 1 2468 2 chr1D.!!$F1 2467
5 TraesCS1B01G110900 chr2A 354528927 354531326 2399 False 1909.0 2464 95.5960 1 2468 2 chr2A.!!$F1 2467
6 TraesCS1B01G110900 chr2A 494099486 494101293 1807 True 1426.0 2486 95.0645 1 1871 2 chr2A.!!$R1 1870
7 TraesCS1B01G110900 chr7D 61521385 61524212 2827 True 1897.5 2396 95.1335 1 2468 2 chr7D.!!$R1 2467
8 TraesCS1B01G110900 chr7A 320507537 320509941 2404 False 1867.0 2396 94.9775 1 2468 2 chr7A.!!$F1 2467
9 TraesCS1B01G110900 chr1A 408631022 408632661 1639 False 2357.0 2357 92.7620 1 1626 1 chr1A.!!$F1 1625
10 TraesCS1B01G110900 chr4D 382846244 382847075 831 True 1365.0 1365 96.2740 1637 2468 1 chr4D.!!$R1 831
11 TraesCS1B01G110900 chr6D 93876313 93877014 701 False 1029.0 1029 93.3140 1775 2468 1 chr6D.!!$F1 693

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
804 1138 0.423956 TGGTCTCCCCCTCCCAAATA 59.576 55.0 0.0 0.0 0.0 1.4 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1605 1942 0.527113 TGCTGAATGCCGAACCATTG 59.473 50.0 1.55 0.0 42.0 2.82 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
138 144 6.089249 ACACAATGAGAAGGTTTTCCATTC 57.911 37.500 0.00 0.00 43.73 2.67
418 460 2.909662 CTCTCCCCTTCCAAGTCTTCTT 59.090 50.000 0.00 0.00 0.00 2.52
525 848 4.247380 GGCGGCCTCCAGATCCAG 62.247 72.222 12.87 0.00 0.00 3.86
609 942 1.074248 CCGTGGTGGCTAGGGTTTT 59.926 57.895 0.00 0.00 0.00 2.43
638 971 2.942796 AACTCGATCCCACGCTGCA 61.943 57.895 0.00 0.00 0.00 4.41
691 1024 0.988145 TCTCCGGGATGGCCTTGATT 60.988 55.000 3.32 0.00 37.80 2.57
715 1048 1.859427 CGAGGACGACCGGTTCTTCA 61.859 60.000 9.42 0.00 42.66 3.02
804 1138 0.423956 TGGTCTCCCCCTCCCAAATA 59.576 55.000 0.00 0.00 0.00 1.40
810 1144 2.718609 CTCCCCCTCCCAAATACATCAT 59.281 50.000 0.00 0.00 0.00 2.45
1171 1508 3.222603 CCAATACTGCCCCCAAATCTAC 58.777 50.000 0.00 0.00 0.00 2.59
1247 1584 6.228258 ACGATGTACTTGAACATAAACCAGT 58.772 36.000 0.00 0.00 40.17 4.00
1265 1602 1.272490 AGTAGTTAGCTGCGCAAGTGA 59.728 47.619 13.05 0.00 41.68 3.41
1293 1630 5.297527 CGAATGATTGGATCTGATTTGGACA 59.702 40.000 0.00 0.00 0.00 4.02
1605 1942 5.749620 TCTTCAGCGATAGTTAACGATCTC 58.250 41.667 21.58 15.99 39.35 2.75
1691 2824 8.608185 ATCCATTTATACTTCCACATGGTTTT 57.392 30.769 0.00 0.00 34.05 2.43
1808 2941 6.453926 TTTGACACGCCATGTAGTATACTA 57.546 37.500 8.59 8.59 43.56 1.82
1832 2965 0.102481 CCGCCTTTCTTCTAGCGCTA 59.898 55.000 17.75 17.75 46.90 4.26
2027 3160 6.422776 ACTAATTAATGAAGGAAGCACACG 57.577 37.500 0.00 0.00 0.00 4.49
2330 3469 6.025749 CCCTATTGGTTGTTTCTTTCTTCC 57.974 41.667 0.00 0.00 0.00 3.46
2366 3505 1.066257 CCACGCTGCTGTTTTGCTT 59.934 52.632 0.00 0.00 0.00 3.91
2391 3530 7.391148 TGCTTGATAATTCTTTTACTGTCCC 57.609 36.000 0.00 0.00 0.00 4.46
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
478 801 1.756950 TTGATAGGAGGTCGCCGCT 60.757 57.895 0.42 0.00 0.00 5.52
525 848 3.376918 GTTGGGCTTGAGCTGGGC 61.377 66.667 0.00 0.00 41.70 5.36
580 913 0.106719 CCACCACGGGCTATGGATTT 60.107 55.000 13.48 0.00 39.87 2.17
609 942 1.945354 GATCGAGTTGGAGGCGACCA 61.945 60.000 2.57 2.57 36.83 4.02
1171 1508 4.022935 TGTTACTTGCAAATTCAGAGGCTG 60.023 41.667 0.00 0.00 0.00 4.85
1265 1602 3.497103 TCAGATCCAATCATTCGGCAT 57.503 42.857 0.00 0.00 0.00 4.40
1355 1692 0.388649 CGTGAAGTAGCAGCCGAAGT 60.389 55.000 0.00 0.00 0.00 3.01
1605 1942 0.527113 TGCTGAATGCCGAACCATTG 59.473 50.000 1.55 0.00 42.00 2.82
1808 2941 2.225727 CGCTAGAAGAAAGGCGGTTTTT 59.774 45.455 0.00 0.00 43.25 1.94
1832 2965 4.703575 TCATCCTAACTAGCGTTGTGTAGT 59.296 41.667 0.00 0.00 34.59 2.73
2027 3160 8.607459 CAGACATATCTTCCTTTATGTGAACAC 58.393 37.037 0.63 0.00 38.74 3.32
2318 3457 3.606687 TCATAGCCCGGAAGAAAGAAAC 58.393 45.455 0.73 0.00 0.00 2.78
2330 3469 0.886490 GGCCATCAACTCATAGCCCG 60.886 60.000 0.00 0.00 34.23 6.13
2366 3505 7.361713 CGGGACAGTAAAAGAATTATCAAGCAA 60.362 37.037 0.00 0.00 0.00 3.91


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.