Multiple sequence alignment - TraesCS1B01G106300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G106300 chr1B 100.000 2795 0 0 1 2795 118089681 118092475 0.000000e+00 5162.0
1 TraesCS1B01G106300 chr1B 98.283 2795 31 3 1 2795 118176424 118173647 0.000000e+00 4879.0
2 TraesCS1B01G106300 chr1B 94.017 585 34 1 82 665 543535371 543535955 0.000000e+00 885.0
3 TraesCS1B01G106300 chr1B 92.988 599 42 0 67 665 550753990 550753392 0.000000e+00 874.0
4 TraesCS1B01G106300 chr1B 94.074 135 8 0 2661 2795 389089376 389089242 3.650000e-49 206.0
5 TraesCS1B01G106300 chr1B 93.382 136 9 0 2660 2795 319161371 319161506 4.720000e-48 202.0
6 TraesCS1B01G106300 chr1B 95.349 43 2 0 1831 1873 118091426 118091468 5.000000e-08 69.4
7 TraesCS1B01G106300 chr1B 95.349 43 2 0 1746 1788 118091511 118091553 5.000000e-08 69.4
8 TraesCS1B01G106300 chr1B 95.349 43 2 0 1746 1788 118174610 118174568 5.000000e-08 69.4
9 TraesCS1B01G106300 chr1B 95.349 43 2 0 1831 1873 118174695 118174653 5.000000e-08 69.4
10 TraesCS1B01G106300 chr1D 94.208 846 33 8 995 1836 74294723 74293890 0.000000e+00 1277.0
11 TraesCS1B01G106300 chr4B 94.518 602 30 3 66 665 180942821 180943421 0.000000e+00 926.0
12 TraesCS1B01G106300 chr4B 92.821 599 41 2 66 663 416782659 416782062 0.000000e+00 867.0
13 TraesCS1B01G106300 chr4B 87.157 693 84 5 1880 2569 18477305 18477995 0.000000e+00 782.0
14 TraesCS1B01G106300 chr4B 94.853 136 5 2 2661 2795 517364354 517364220 7.840000e-51 211.0
15 TraesCS1B01G106300 chr4B 94.074 135 8 0 2661 2795 653974039 653973905 3.650000e-49 206.0
16 TraesCS1B01G106300 chr6B 94.147 598 33 2 68 664 692012175 692012771 0.000000e+00 909.0
17 TraesCS1B01G106300 chr6B 85.350 157 16 4 666 815 116458169 116458013 3.730000e-34 156.0
18 TraesCS1B01G106300 chr5B 93.367 603 38 2 66 667 489389571 489388970 0.000000e+00 891.0
19 TraesCS1B01G106300 chr2B 89.956 687 63 6 1886 2569 800318182 800317499 0.000000e+00 881.0
20 TraesCS1B01G106300 chr2B 89.333 150 16 0 666 815 638729276 638729425 3.680000e-44 189.0
21 TraesCS1B01G106300 chr2B 100.000 31 0 0 2630 2660 503939108 503939078 1.080000e-04 58.4
22 TraesCS1B01G106300 chr3D 92.508 614 42 4 66 677 563634655 563635266 0.000000e+00 876.0
23 TraesCS1B01G106300 chr7D 89.665 687 66 5 1886 2569 365281831 365281147 0.000000e+00 870.0
24 TraesCS1B01G106300 chr7D 88.167 693 78 4 1880 2569 30927015 30927706 0.000000e+00 822.0
25 TraesCS1B01G106300 chr5D 92.833 600 41 2 67 664 13738304 13737705 0.000000e+00 869.0
26 TraesCS1B01G106300 chr5D 100.000 30 0 0 2631 2660 125996009 125995980 3.890000e-04 56.5
27 TraesCS1B01G106300 chr3B 89.520 687 66 6 1886 2569 821196562 821195879 0.000000e+00 865.0
28 TraesCS1B01G106300 chr4A 88.808 688 70 7 1886 2569 455855013 455854329 0.000000e+00 837.0
29 TraesCS1B01G106300 chr4D 88.338 686 76 4 1886 2569 118242215 118241532 0.000000e+00 821.0
30 TraesCS1B01G106300 chr4D 100.000 30 0 0 2631 2660 245467099 245467070 3.890000e-04 56.5
31 TraesCS1B01G106300 chr4D 100.000 30 0 0 2631 2660 282093062 282093091 3.890000e-04 56.5
32 TraesCS1B01G106300 chr1A 93.123 538 37 0 1141 1678 74320474 74321011 0.000000e+00 789.0
33 TraesCS1B01G106300 chr1A 93.491 169 9 1 1670 1836 74326518 74326686 1.660000e-62 250.0
34 TraesCS1B01G106300 chr1A 97.561 82 1 1 995 1075 74320390 74320471 3.750000e-29 139.0
35 TraesCS1B01G106300 chr1A 94.872 39 1 1 912 950 74320268 74320305 3.010000e-05 60.2
36 TraesCS1B01G106300 chr1A 100.000 30 0 0 2631 2660 391682051 391682080 3.890000e-04 56.5
37 TraesCS1B01G106300 chr1A 100.000 30 0 0 2631 2660 391706338 391706367 3.890000e-04 56.5
38 TraesCS1B01G106300 chr1A 100.000 30 0 0 2631 2660 391767154 391767183 3.890000e-04 56.5
39 TraesCS1B01G106300 chr5A 87.149 677 81 6 1880 2553 108912805 108913478 0.000000e+00 763.0
40 TraesCS1B01G106300 chr2A 94.815 135 7 0 2661 2795 177873709 177873575 7.840000e-51 211.0
41 TraesCS1B01G106300 chr2A 94.815 135 7 0 2661 2795 177984893 177984759 7.840000e-51 211.0
42 TraesCS1B01G106300 chrUn 94.074 135 8 0 2661 2795 13788715 13788581 3.650000e-49 206.0
43 TraesCS1B01G106300 chr6D 94.074 135 8 0 2661 2795 462051213 462051079 3.650000e-49 206.0
44 TraesCS1B01G106300 chr2D 100.000 30 0 0 2631 2660 7272773 7272802 3.890000e-04 56.5


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G106300 chr1B 118089681 118092475 2794 False 1766.933333 5162 96.899333 1 2795 3 chr1B.!!$F3 2794
1 TraesCS1B01G106300 chr1B 118173647 118176424 2777 True 1672.600000 4879 96.327000 1 2795 3 chr1B.!!$R3 2794
2 TraesCS1B01G106300 chr1B 543535371 543535955 584 False 885.000000 885 94.017000 82 665 1 chr1B.!!$F2 583
3 TraesCS1B01G106300 chr1B 550753392 550753990 598 True 874.000000 874 92.988000 67 665 1 chr1B.!!$R2 598
4 TraesCS1B01G106300 chr1D 74293890 74294723 833 True 1277.000000 1277 94.208000 995 1836 1 chr1D.!!$R1 841
5 TraesCS1B01G106300 chr4B 180942821 180943421 600 False 926.000000 926 94.518000 66 665 1 chr4B.!!$F2 599
6 TraesCS1B01G106300 chr4B 416782062 416782659 597 True 867.000000 867 92.821000 66 663 1 chr4B.!!$R1 597
7 TraesCS1B01G106300 chr4B 18477305 18477995 690 False 782.000000 782 87.157000 1880 2569 1 chr4B.!!$F1 689
8 TraesCS1B01G106300 chr6B 692012175 692012771 596 False 909.000000 909 94.147000 68 664 1 chr6B.!!$F1 596
9 TraesCS1B01G106300 chr5B 489388970 489389571 601 True 891.000000 891 93.367000 66 667 1 chr5B.!!$R1 601
10 TraesCS1B01G106300 chr2B 800317499 800318182 683 True 881.000000 881 89.956000 1886 2569 1 chr2B.!!$R2 683
11 TraesCS1B01G106300 chr3D 563634655 563635266 611 False 876.000000 876 92.508000 66 677 1 chr3D.!!$F1 611
12 TraesCS1B01G106300 chr7D 365281147 365281831 684 True 870.000000 870 89.665000 1886 2569 1 chr7D.!!$R1 683
13 TraesCS1B01G106300 chr7D 30927015 30927706 691 False 822.000000 822 88.167000 1880 2569 1 chr7D.!!$F1 689
14 TraesCS1B01G106300 chr5D 13737705 13738304 599 True 869.000000 869 92.833000 67 664 1 chr5D.!!$R1 597
15 TraesCS1B01G106300 chr3B 821195879 821196562 683 True 865.000000 865 89.520000 1886 2569 1 chr3B.!!$R1 683
16 TraesCS1B01G106300 chr4A 455854329 455855013 684 True 837.000000 837 88.808000 1886 2569 1 chr4A.!!$R1 683
17 TraesCS1B01G106300 chr4D 118241532 118242215 683 True 821.000000 821 88.338000 1886 2569 1 chr4D.!!$R1 683
18 TraesCS1B01G106300 chr1A 74320268 74321011 743 False 329.400000 789 95.185333 912 1678 3 chr1A.!!$F5 766
19 TraesCS1B01G106300 chr5A 108912805 108913478 673 False 763.000000 763 87.149000 1880 2553 1 chr5A.!!$F1 673

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
777 781 0.535335 ATCAAGCGAGGCGGTTTAGA 59.465 50.0 1.18 0.0 45.2 2.1 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2664 2723 2.959484 CGACCTGGCCCACTCACAT 61.959 63.158 0.0 0.0 0.0 3.21 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
23 24 0.732880 CTGGCGTTGTGAGGTAGACG 60.733 60.000 0.00 0.00 38.45 4.18
181 183 5.815740 GTGTTTCGTCCTACATATTCATGGT 59.184 40.000 0.00 0.00 36.39 3.55
429 431 3.744003 ATACCCGGCAGGCGTCCTA 62.744 63.158 16.17 1.63 40.58 2.94
761 765 2.431771 CGGGACACGCGTCAATCA 60.432 61.111 9.86 0.00 44.54 2.57
762 766 2.024868 CGGGACACGCGTCAATCAA 61.025 57.895 9.86 0.00 44.54 2.57
763 767 1.787847 GGGACACGCGTCAATCAAG 59.212 57.895 9.86 0.00 44.54 3.02
764 768 1.132640 GGACACGCGTCAATCAAGC 59.867 57.895 9.86 0.00 44.54 4.01
769 773 2.401195 GCGTCAATCAAGCGAGGC 59.599 61.111 0.00 0.00 36.07 4.70
770 774 2.697425 CGTCAATCAAGCGAGGCG 59.303 61.111 0.00 0.00 0.00 5.52
777 781 0.535335 ATCAAGCGAGGCGGTTTAGA 59.465 50.000 1.18 0.00 45.20 2.10
862 866 4.152647 ACAGGTGTCTCTGTGACTATGAA 58.847 43.478 10.76 0.00 45.27 2.57
2229 2286 4.013728 AGCACAACCCGAATTTATAGCAA 58.986 39.130 0.00 0.00 0.00 3.91
2582 2641 0.847314 TCGGGATGGAAGGGGGAAAA 60.847 55.000 0.00 0.00 0.00 2.29
2597 2656 2.578480 GGGAAAATGGAACCTCTCCTCT 59.422 50.000 0.00 0.00 45.64 3.69
2599 2658 4.265893 GGAAAATGGAACCTCTCCTCTTC 58.734 47.826 0.00 0.00 45.64 2.87
2760 2819 9.736023 GTATGATTCCCAGTAAATTGATTTGAC 57.264 33.333 0.00 0.00 0.00 3.18
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
23 24 2.159043 TCCATCCACATCTCGCTTCTTC 60.159 50.000 0.00 0.0 0.00 2.87
670 674 2.067013 CGTTCTTTCTTCCCCTTCGTC 58.933 52.381 0.00 0.0 0.00 4.20
757 761 1.066430 TCTAAACCGCCTCGCTTGATT 60.066 47.619 0.00 0.0 0.00 2.57
758 762 0.535335 TCTAAACCGCCTCGCTTGAT 59.465 50.000 0.00 0.0 0.00 2.57
759 763 0.319083 TTCTAAACCGCCTCGCTTGA 59.681 50.000 0.00 0.0 0.00 3.02
760 764 1.128692 CTTTCTAAACCGCCTCGCTTG 59.871 52.381 0.00 0.0 0.00 4.01
761 765 1.439679 CTTTCTAAACCGCCTCGCTT 58.560 50.000 0.00 0.0 0.00 4.68
762 766 1.019805 GCTTTCTAAACCGCCTCGCT 61.020 55.000 0.00 0.0 0.00 4.93
763 767 1.019805 AGCTTTCTAAACCGCCTCGC 61.020 55.000 0.00 0.0 0.00 5.03
764 768 0.721718 CAGCTTTCTAAACCGCCTCG 59.278 55.000 0.00 0.0 0.00 4.63
765 769 1.809684 ACAGCTTTCTAAACCGCCTC 58.190 50.000 0.00 0.0 0.00 4.70
766 770 1.880027 CAACAGCTTTCTAAACCGCCT 59.120 47.619 0.00 0.0 0.00 5.52
767 771 1.068541 CCAACAGCTTTCTAAACCGCC 60.069 52.381 0.00 0.0 0.00 6.13
768 772 1.877443 TCCAACAGCTTTCTAAACCGC 59.123 47.619 0.00 0.0 0.00 5.68
769 773 3.751175 TGATCCAACAGCTTTCTAAACCG 59.249 43.478 0.00 0.0 0.00 4.44
770 774 4.762251 ACTGATCCAACAGCTTTCTAAACC 59.238 41.667 0.00 0.0 41.06 3.27
777 781 1.072331 ACCGACTGATCCAACAGCTTT 59.928 47.619 0.00 0.0 41.06 3.51
862 866 3.782656 AGATTTTTAGGTGACCACGGT 57.217 42.857 3.63 0.0 0.00 4.83
2229 2286 3.427503 CGCACCAAATCCGCTAGAAAATT 60.428 43.478 0.00 0.0 0.00 1.82
2664 2723 2.959484 CGACCTGGCCCACTCACAT 61.959 63.158 0.00 0.0 0.00 3.21
2723 2782 3.233507 GGGAATCATACCCATGCATGTT 58.766 45.455 24.58 13.8 46.05 2.71


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.