Multiple sequence alignment - TraesCS1B01G103300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G103300 chr1B 100.000 2882 0 0 1 2882 113317348 113314467 0.000000e+00 5323.0
1 TraesCS1B01G103300 chr1B 99.306 2882 17 1 1 2882 113500136 113497258 0.000000e+00 5208.0
2 TraesCS1B01G103300 chr1B 99.334 1801 12 0 1082 2882 113213906 113212106 0.000000e+00 3260.0
3 TraesCS1B01G103300 chr1B 98.346 1088 18 0 1 1088 113215231 113214144 0.000000e+00 1910.0
4 TraesCS1B01G103300 chr1B 84.100 2000 262 40 900 2855 113516847 113514860 0.000000e+00 1881.0
5 TraesCS1B01G103300 chr1B 99.194 993 8 0 1 993 113410125 113409133 0.000000e+00 1790.0
6 TraesCS1B01G103300 chr1B 78.328 1615 281 41 1149 2732 113026218 113024642 0.000000e+00 979.0
7 TraesCS1B01G103300 chr1B 78.658 1565 265 40 1051 2573 50992299 50993836 0.000000e+00 976.0
8 TraesCS1B01G103300 chr1B 99.624 266 1 0 2617 2882 113407767 113407502 1.200000e-133 486.0
9 TraesCS1B01G103300 chr1B 100.000 147 0 0 842 988 113496308 113496454 3.660000e-69 272.0
10 TraesCS1B01G103300 chr1B 99.320 147 1 0 842 988 113211156 113211302 1.700000e-67 267.0
11 TraesCS1B01G103300 chr1B 99.320 147 1 0 842 988 113406556 113406702 1.700000e-67 267.0
12 TraesCS1B01G103300 chr1B 98.639 147 2 0 842 988 113313517 113313663 7.920000e-66 261.0
13 TraesCS1B01G103300 chrUn 99.719 1777 5 0 995 2771 372932431 372934207 0.000000e+00 3254.0
14 TraesCS1B01G103300 chr1D 93.557 1971 93 13 938 2881 72435729 72433766 0.000000e+00 2905.0
15 TraesCS1B01G103300 chr1D 82.209 1394 223 17 1497 2880 72459630 72458252 0.000000e+00 1177.0
16 TraesCS1B01G103300 chr1D 82.079 1395 224 18 1497 2880 72443223 72441844 0.000000e+00 1168.0
17 TraesCS1B01G103300 chr1D 78.964 1602 281 35 1149 2732 71769954 71768391 0.000000e+00 1040.0
18 TraesCS1B01G103300 chr1D 74.089 1756 334 79 816 2508 71640069 71638372 6.830000e-171 610.0
19 TraesCS1B01G103300 chr5B 78.094 1196 233 25 1551 2733 411744253 411743074 0.000000e+00 730.0
20 TraesCS1B01G103300 chr5D 77.739 1141 209 34 1045 2153 350689286 350688159 0.000000e+00 658.0
21 TraesCS1B01G103300 chr1A 75.050 1491 283 49 1146 2583 71724976 71723522 6.830000e-171 610.0
22 TraesCS1B01G103300 chr1A 75.117 213 40 9 1184 1388 570787900 570787693 1.420000e-13 87.9
23 TraesCS1B01G103300 chr3D 76.190 273 39 14 24 275 94740955 94740688 1.400000e-23 121.0
24 TraesCS1B01G103300 chr6B 82.222 135 24 0 1153 1287 82958228 82958094 1.810000e-22 117.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G103300 chr1B 113314467 113317348 2881 True 5323 5323 100.000 1 2882 1 chr1B.!!$R2 2881
1 TraesCS1B01G103300 chr1B 113497258 113500136 2878 True 5208 5208 99.306 1 2882 1 chr1B.!!$R3 2881
2 TraesCS1B01G103300 chr1B 113212106 113215231 3125 True 2585 3260 98.840 1 2882 2 chr1B.!!$R5 2881
3 TraesCS1B01G103300 chr1B 113514860 113516847 1987 True 1881 1881 84.100 900 2855 1 chr1B.!!$R4 1955
4 TraesCS1B01G103300 chr1B 113407502 113410125 2623 True 1138 1790 99.409 1 2882 2 chr1B.!!$R6 2881
5 TraesCS1B01G103300 chr1B 113024642 113026218 1576 True 979 979 78.328 1149 2732 1 chr1B.!!$R1 1583
6 TraesCS1B01G103300 chr1B 50992299 50993836 1537 False 976 976 78.658 1051 2573 1 chr1B.!!$F1 1522
7 TraesCS1B01G103300 chrUn 372932431 372934207 1776 False 3254 3254 99.719 995 2771 1 chrUn.!!$F1 1776
8 TraesCS1B01G103300 chr1D 72433766 72435729 1963 True 2905 2905 93.557 938 2881 1 chr1D.!!$R3 1943
9 TraesCS1B01G103300 chr1D 72458252 72459630 1378 True 1177 1177 82.209 1497 2880 1 chr1D.!!$R5 1383
10 TraesCS1B01G103300 chr1D 72441844 72443223 1379 True 1168 1168 82.079 1497 2880 1 chr1D.!!$R4 1383
11 TraesCS1B01G103300 chr1D 71768391 71769954 1563 True 1040 1040 78.964 1149 2732 1 chr1D.!!$R2 1583
12 TraesCS1B01G103300 chr1D 71638372 71640069 1697 True 610 610 74.089 816 2508 1 chr1D.!!$R1 1692
13 TraesCS1B01G103300 chr5B 411743074 411744253 1179 True 730 730 78.094 1551 2733 1 chr5B.!!$R1 1182
14 TraesCS1B01G103300 chr5D 350688159 350689286 1127 True 658 658 77.739 1045 2153 1 chr5D.!!$R1 1108
15 TraesCS1B01G103300 chr1A 71723522 71724976 1454 True 610 610 75.050 1146 2583 1 chr1A.!!$R1 1437

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
352 353 0.971386 GTTCAGTTCCCGTGGACCTA 59.029 55.0 0.0 0.0 0.0 3.08 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1888 2211 3.231818 CCCGGATAATCTCACTACCTGT 58.768 50.0 0.73 0.0 0.0 4.0 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
210 211 0.987081 ATGCAGGAGGTCATGGAGCT 60.987 55.000 0.00 0.0 43.43 4.09
350 351 1.302271 GGTTCAGTTCCCGTGGACC 60.302 63.158 0.00 0.0 36.38 4.46
352 353 0.971386 GTTCAGTTCCCGTGGACCTA 59.029 55.000 0.00 0.0 0.00 3.08
447 448 9.879973 CTTTATTAATTTAAAACCGAACGCATG 57.120 29.630 0.00 0.0 0.00 4.06
577 578 1.679153 GTGCACCTTTCTTTCGGGAAA 59.321 47.619 5.22 0.0 34.55 3.13
1888 2211 1.202663 TGTTGTTACGTTAGCCAGGCA 60.203 47.619 15.80 0.0 0.00 4.75
2771 3224 5.005971 GCTTCGTTCGCAAATTATGTACCTA 59.994 40.000 0.00 0.0 0.00 3.08
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
46 47 2.038269 CCCAAACGCTACGCCACAT 61.038 57.895 0.00 0.0 0.0 3.21
210 211 2.715749 AATCCGAATGCACCTGATCA 57.284 45.000 0.00 0.0 0.0 2.92
691 692 4.825546 AATCTGCTCAAATTATGCTCGG 57.174 40.909 0.00 0.0 0.0 4.63
1888 2211 3.231818 CCCGGATAATCTCACTACCTGT 58.768 50.000 0.73 0.0 0.0 4.00
2771 3224 1.238439 CGGAAGACAGCACAACCATT 58.762 50.000 0.00 0.0 0.0 3.16


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.