Multiple sequence alignment - TraesCS1B01G103200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G103200 chr1B 100.000 2762 0 0 1 2762 113316415 113313654 0.000000e+00 5101.0
1 TraesCS1B01G103200 chr1B 99.457 2762 12 1 1 2762 113499203 113496445 0.000000e+00 5014.0
2 TraesCS1B01G103200 chr1B 99.273 2614 19 0 149 2762 113213906 113211293 0.000000e+00 4723.0
3 TraesCS1B01G103200 chr1B 82.713 2366 323 57 5 2312 113516808 113514471 0.000000e+00 2025.0
4 TraesCS1B01G103200 chr1B 99.166 1079 5 1 1684 2762 113407767 113406693 0.000000e+00 1940.0
5 TraesCS1B01G103200 chr1B 78.328 1615 281 41 216 1799 113026218 113024642 0.000000e+00 979.0
6 TraesCS1B01G103200 chr1B 78.658 1565 265 40 118 1640 50992299 50993836 0.000000e+00 976.0
7 TraesCS1B01G103200 chr1B 98.065 155 3 0 1 155 113214298 113214144 1.260000e-68 270.0
8 TraesCS1B01G103200 chr1B 100.000 60 0 0 1 60 113409192 113409133 8.090000e-21 111.0
9 TraesCS1B01G103200 chr1B 100.000 55 0 0 1 55 113496400 113496454 4.870000e-18 102.0
10 TraesCS1B01G103200 chr1B 100.000 54 0 0 2 55 113406649 113406702 1.750000e-17 100.0
11 TraesCS1B01G103200 chr1B 98.182 55 1 0 1 55 113211248 113211302 2.260000e-16 97.1
12 TraesCS1B01G103200 chr1B 98.148 54 1 0 2 55 113313610 113313663 8.140000e-16 95.3
13 TraesCS1B01G103200 chrUn 99.719 1777 5 0 62 1838 372932431 372934207 0.000000e+00 3254.0
14 TraesCS1B01G103200 chr1D 93.523 2146 105 13 5 2123 72435729 72433591 0.000000e+00 3162.0
15 TraesCS1B01G103200 chr1D 80.609 1872 276 49 564 2392 72459630 72457803 0.000000e+00 1365.0
16 TraesCS1B01G103200 chr1D 80.566 1873 276 48 564 2392 72443223 72441395 0.000000e+00 1362.0
17 TraesCS1B01G103200 chr1D 78.964 1602 281 35 216 1799 71769954 71768391 0.000000e+00 1040.0
18 TraesCS1B01G103200 chr1D 74.076 1624 319 65 5 1575 71639946 71638372 8.580000e-160 573.0
19 TraesCS1B01G103200 chr1D 77.174 184 23 11 2350 2516 71768017 71767836 3.790000e-14 89.8
20 TraesCS1B01G103200 chr1A 78.817 1860 328 43 114 1947 32190979 32192798 0.000000e+00 1192.0
21 TraesCS1B01G103200 chr1A 75.050 1491 283 49 213 1650 71724976 71723522 6.540000e-171 610.0
22 TraesCS1B01G103200 chr1A 75.117 213 40 9 251 455 570787900 570787693 1.360000e-13 87.9
23 TraesCS1B01G103200 chr5B 78.094 1196 233 25 618 1800 411744253 411743074 0.000000e+00 730.0
24 TraesCS1B01G103200 chr5B 95.951 247 10 0 2509 2755 523959543 523959297 4.280000e-108 401.0
25 TraesCS1B01G103200 chr5D 77.739 1141 209 34 112 1220 350689286 350688159 0.000000e+00 658.0
26 TraesCS1B01G103200 chr4D 97.500 240 6 0 2516 2755 10756004 10756243 7.120000e-111 411.0
27 TraesCS1B01G103200 chr7B 96.694 242 8 0 2514 2755 125853926 125854167 1.190000e-108 403.0
28 TraesCS1B01G103200 chr7B 96.281 242 9 0 2514 2755 145817346 145817105 5.540000e-107 398.0
29 TraesCS1B01G103200 chr4B 96.281 242 9 0 2514 2755 532585978 532585737 5.540000e-107 398.0
30 TraesCS1B01G103200 chr3B 96.266 241 6 2 2516 2755 160148111 160148349 2.580000e-105 392.0
31 TraesCS1B01G103200 chr6B 82.222 135 24 0 220 354 82958228 82958094 1.740000e-22 117.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G103200 chr1B 113313654 113316415 2761 True 5101.0 5101 100.000 1 2762 1 chr1B.!!$R2 2761
1 TraesCS1B01G103200 chr1B 113496445 113499203 2758 True 5014.0 5014 99.457 1 2762 1 chr1B.!!$R3 2761
2 TraesCS1B01G103200 chr1B 113211293 113214298 3005 True 2496.5 4723 98.669 1 2762 2 chr1B.!!$R5 2761
3 TraesCS1B01G103200 chr1B 113514471 113516808 2337 True 2025.0 2025 82.713 5 2312 1 chr1B.!!$R4 2307
4 TraesCS1B01G103200 chr1B 113406693 113409192 2499 True 1025.5 1940 99.583 1 2762 2 chr1B.!!$R6 2761
5 TraesCS1B01G103200 chr1B 113024642 113026218 1576 True 979.0 979 78.328 216 1799 1 chr1B.!!$R1 1583
6 TraesCS1B01G103200 chr1B 50992299 50993836 1537 False 976.0 976 78.658 118 1640 1 chr1B.!!$F1 1522
7 TraesCS1B01G103200 chrUn 372932431 372934207 1776 False 3254.0 3254 99.719 62 1838 1 chrUn.!!$F1 1776
8 TraesCS1B01G103200 chr1D 72433591 72435729 2138 True 3162.0 3162 93.523 5 2123 1 chr1D.!!$R2 2118
9 TraesCS1B01G103200 chr1D 72457803 72459630 1827 True 1365.0 1365 80.609 564 2392 1 chr1D.!!$R4 1828
10 TraesCS1B01G103200 chr1D 72441395 72443223 1828 True 1362.0 1362 80.566 564 2392 1 chr1D.!!$R3 1828
11 TraesCS1B01G103200 chr1D 71638372 71639946 1574 True 573.0 573 74.076 5 1575 1 chr1D.!!$R1 1570
12 TraesCS1B01G103200 chr1D 71767836 71769954 2118 True 564.9 1040 78.069 216 2516 2 chr1D.!!$R5 2300
13 TraesCS1B01G103200 chr1A 32190979 32192798 1819 False 1192.0 1192 78.817 114 1947 1 chr1A.!!$F1 1833
14 TraesCS1B01G103200 chr1A 71723522 71724976 1454 True 610.0 610 75.050 213 1650 1 chr1A.!!$R1 1437
15 TraesCS1B01G103200 chr5B 411743074 411744253 1179 True 730.0 730 78.094 618 1800 1 chr5B.!!$R1 1182
16 TraesCS1B01G103200 chr5D 350688159 350689286 1127 True 658.0 658 77.739 112 1220 1 chr5D.!!$R1 1108

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
955 1259 1.202663 TGTTGTTACGTTAGCCAGGCA 60.203 47.619 15.8 0.0 0.0 4.75 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1838 2276 1.238439 CGGAAGACAGCACAACCATT 58.762 50.0 0.0 0.0 0.0 3.16 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
955 1259 1.202663 TGTTGTTACGTTAGCCAGGCA 60.203 47.619 15.8 0.0 0.0 4.75
1838 2276 5.005971 GCTTCGTTCGCAAATTATGTACCTA 59.994 40.000 0.0 0.0 0.0 3.08
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
955 1259 3.231818 CCCGGATAATCTCACTACCTGT 58.768 50.0 0.73 0.0 0.0 4.00
1838 2276 1.238439 CGGAAGACAGCACAACCATT 58.762 50.0 0.00 0.0 0.0 3.16


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.