Multiple sequence alignment - TraesCS1B01G087000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G087000 chr1B 100.000 2642 0 0 1 2642 80710621 80707980 0 4879
1 TraesCS1B01G087000 chr1B 99.289 1829 11 1 1 1829 544593532 544595358 0 3304
2 TraesCS1B01G087000 chr1B 99.125 1829 16 0 1 1829 544623471 544625299 0 3290
3 TraesCS1B01G087000 chr1B 99.386 814 5 0 1829 2642 79692852 79692039 0 1476
4 TraesCS1B01G087000 chr1B 99.263 814 6 0 1829 2642 80696218 80695405 0 1471
5 TraesCS1B01G087000 chr1B 99.140 814 7 0 1829 2642 80355731 80356544 0 1465
6 TraesCS1B01G087000 chr1B 99.140 814 7 0 1829 2642 356837491 356836678 0 1465
7 TraesCS1B01G087000 chrUn 99.289 1829 13 0 1 1829 229310392 229308564 0 3306
8 TraesCS1B01G087000 chrUn 99.289 1829 13 0 1 1829 291535275 291537103 0 3306
9 TraesCS1B01G087000 chrUn 99.235 1829 14 0 1 1829 199874659 199876487 0 3301
10 TraesCS1B01G087000 chrUn 99.126 1830 15 1 1 1829 274341447 274339618 0 3290
11 TraesCS1B01G087000 chrUn 99.071 1829 17 0 1 1829 3845979 3844151 0 3284
12 TraesCS1B01G087000 chrUn 99.071 1829 17 0 1 1829 67501173 67499345 0 3284
13 TraesCS1B01G087000 chrUn 99.071 1829 17 0 1 1829 199904579 199906407 0 3284
14 TraesCS1B01G087000 chrUn 99.263 814 6 0 1829 2642 153686680 153685867 0 1471
15 TraesCS1B01G087000 chr2B 99.263 814 6 0 1829 2642 532683666 532682853 0 1471
16 TraesCS1B01G087000 chr2B 98.430 828 12 1 1815 2642 102363980 102364806 0 1456
17 TraesCS1B01G087000 chr4B 99.023 819 8 0 1824 2642 367127333 367126515 0 1469
18 TraesCS1B01G087000 chr3A 99.140 814 7 0 1829 2642 220338454 220337641 0 1465


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G087000 chr1B 80707980 80710621 2641 True 4879 4879 100.000 1 2642 1 chr1B.!!$R3 2641
1 TraesCS1B01G087000 chr1B 544593532 544595358 1826 False 3304 3304 99.289 1 1829 1 chr1B.!!$F2 1828
2 TraesCS1B01G087000 chr1B 544623471 544625299 1828 False 3290 3290 99.125 1 1829 1 chr1B.!!$F3 1828
3 TraesCS1B01G087000 chr1B 79692039 79692852 813 True 1476 1476 99.386 1829 2642 1 chr1B.!!$R1 813
4 TraesCS1B01G087000 chr1B 80695405 80696218 813 True 1471 1471 99.263 1829 2642 1 chr1B.!!$R2 813
5 TraesCS1B01G087000 chr1B 80355731 80356544 813 False 1465 1465 99.140 1829 2642 1 chr1B.!!$F1 813
6 TraesCS1B01G087000 chr1B 356836678 356837491 813 True 1465 1465 99.140 1829 2642 1 chr1B.!!$R4 813
7 TraesCS1B01G087000 chrUn 229308564 229310392 1828 True 3306 3306 99.289 1 1829 1 chrUn.!!$R4 1828
8 TraesCS1B01G087000 chrUn 291535275 291537103 1828 False 3306 3306 99.289 1 1829 1 chrUn.!!$F3 1828
9 TraesCS1B01G087000 chrUn 199874659 199876487 1828 False 3301 3301 99.235 1 1829 1 chrUn.!!$F1 1828
10 TraesCS1B01G087000 chrUn 274339618 274341447 1829 True 3290 3290 99.126 1 1829 1 chrUn.!!$R5 1828
11 TraesCS1B01G087000 chrUn 3844151 3845979 1828 True 3284 3284 99.071 1 1829 1 chrUn.!!$R1 1828
12 TraesCS1B01G087000 chrUn 67499345 67501173 1828 True 3284 3284 99.071 1 1829 1 chrUn.!!$R2 1828
13 TraesCS1B01G087000 chrUn 199904579 199906407 1828 False 3284 3284 99.071 1 1829 1 chrUn.!!$F2 1828
14 TraesCS1B01G087000 chrUn 153685867 153686680 813 True 1471 1471 99.263 1829 2642 1 chrUn.!!$R3 813
15 TraesCS1B01G087000 chr2B 532682853 532683666 813 True 1471 1471 99.263 1829 2642 1 chr2B.!!$R1 813
16 TraesCS1B01G087000 chr2B 102363980 102364806 826 False 1456 1456 98.430 1815 2642 1 chr2B.!!$F1 827
17 TraesCS1B01G087000 chr4B 367126515 367127333 818 True 1469 1469 99.023 1824 2642 1 chr4B.!!$R1 818
18 TraesCS1B01G087000 chr3A 220337641 220338454 813 True 1465 1465 99.140 1829 2642 1 chr3A.!!$R1 813

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
164 165 1.236628 GGAGGCTCGAAGCGATACTA 58.763 55.0 8.69 0.0 43.62 1.82 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1755 1756 0.960364 ATTTCACTTGCGCCCGTGAT 60.96 50.0 23.67 11.55 39.63 3.06 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
164 165 1.236628 GGAGGCTCGAAGCGATACTA 58.763 55.000 8.69 0.0 43.62 1.82
1185 1186 2.969821 TGGAACAATGTAGGCAAGGT 57.030 45.000 0.00 0.0 31.92 3.50
1225 1226 4.506758 CCGTAACTTCGGGAAAAGGATTA 58.493 43.478 0.00 0.0 45.88 1.75
1692 1693 0.252558 AGCGGGGAAAGAAGACCCTA 60.253 55.000 0.00 0.0 44.97 3.53
1755 1756 2.116238 GTGTAGGATAAGTGGGAGCCA 58.884 52.381 0.00 0.0 0.00 4.75
1934 1936 3.810896 CGCCTTACCTTTGCCCGC 61.811 66.667 0.00 0.0 0.00 6.13
2341 2343 6.723298 AACAACTAGATAGTCAGATCCCAG 57.277 41.667 0.00 0.0 34.99 4.45
2378 2380 9.524106 CATTTCAATCATACACACAATATGCTT 57.476 29.630 0.00 0.0 31.26 3.91
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
710 711 2.650116 AAGATCTGCACCGACGCCT 61.650 57.895 0.00 0.00 0.00 5.52
712 713 2.456119 CCAAGATCTGCACCGACGC 61.456 63.158 0.00 0.00 0.00 5.19
796 797 1.247567 GCTTACCCATGTGCAAGTGT 58.752 50.000 0.00 0.00 0.00 3.55
1185 1186 1.729284 GGATCCGTTTTGCCGACTTA 58.271 50.000 0.00 0.00 0.00 2.24
1225 1226 1.685421 GAGCCCAGTCCTCAGAGCT 60.685 63.158 0.00 0.00 0.00 4.09
1433 1434 1.815003 CGAGGACCATCGCAATGCA 60.815 57.895 5.91 0.00 35.66 3.96
1692 1693 3.129638 GTCGGACTAGAGTCAAGCTCAAT 59.870 47.826 11.64 0.00 46.47 2.57
1755 1756 0.960364 ATTTCACTTGCGCCCGTGAT 60.960 50.000 23.67 11.55 39.63 3.06
1906 1908 2.601067 TAAGGCGACACCCGTGGA 60.601 61.111 0.00 0.00 40.58 4.02
1934 1936 2.008697 CAAAAGGCGCAAACGGTCG 61.009 57.895 10.83 0.00 40.57 4.79
2341 2343 7.645340 GTGTATGATTGAAATGCTTGGTATGTC 59.355 37.037 0.00 0.00 0.00 3.06
2378 2380 6.487689 TGTTTCGTTGTATTGCACATATCA 57.512 33.333 0.00 0.00 36.90 2.15


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.