Multiple sequence alignment - TraesCS1B01G082200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G082200 chr1B 100.000 3505 0 0 1 3505 65600597 65597093 0 6473
1 TraesCS1B01G082200 chr7A 98.547 3510 46 5 1 3505 690916408 690912899 0 6194
2 TraesCS1B01G082200 chr7A 98.489 3508 50 3 1 3505 393656387 393652880 0 6181
3 TraesCS1B01G082200 chr7A 98.489 3508 50 3 1 3505 457554022 457557529 0 6181
4 TraesCS1B01G082200 chr3B 98.547 3510 45 6 1 3505 642076064 642079572 0 6194
5 TraesCS1B01G082200 chr3B 98.491 3512 45 8 1 3505 542914472 542910962 0 6185
6 TraesCS1B01G082200 chr3B 98.460 3507 51 3 1 3505 193977297 193973792 0 6174
7 TraesCS1B01G082200 chr3B 98.375 3508 51 6 1 3505 706338585 706335081 0 6157
8 TraesCS1B01G082200 chr5A 98.490 3510 47 6 1 3505 400082548 400079040 0 6183
9 TraesCS1B01G082200 chr3A 98.490 3509 48 5 1 3505 591390327 591386820 0 6181


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G082200 chr1B 65597093 65600597 3504 True 6473 6473 100.000 1 3505 1 chr1B.!!$R1 3504
1 TraesCS1B01G082200 chr7A 690912899 690916408 3509 True 6194 6194 98.547 1 3505 1 chr7A.!!$R2 3504
2 TraesCS1B01G082200 chr7A 393652880 393656387 3507 True 6181 6181 98.489 1 3505 1 chr7A.!!$R1 3504
3 TraesCS1B01G082200 chr7A 457554022 457557529 3507 False 6181 6181 98.489 1 3505 1 chr7A.!!$F1 3504
4 TraesCS1B01G082200 chr3B 642076064 642079572 3508 False 6194 6194 98.547 1 3505 1 chr3B.!!$F1 3504
5 TraesCS1B01G082200 chr3B 542910962 542914472 3510 True 6185 6185 98.491 1 3505 1 chr3B.!!$R2 3504
6 TraesCS1B01G082200 chr3B 193973792 193977297 3505 True 6174 6174 98.460 1 3505 1 chr3B.!!$R1 3504
7 TraesCS1B01G082200 chr3B 706335081 706338585 3504 True 6157 6157 98.375 1 3505 1 chr3B.!!$R3 3504
8 TraesCS1B01G082200 chr5A 400079040 400082548 3508 True 6183 6183 98.490 1 3505 1 chr5A.!!$R1 3504
9 TraesCS1B01G082200 chr3A 591386820 591390327 3507 True 6181 6181 98.490 1 3505 1 chr3A.!!$R1 3504

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
32 33 0.033228 CGAAATTTGGGGTTGCAGCA 59.967 50.000 2.05 0.0 0.00 4.41 F
426 430 2.268298 GCAGTATGACCGAACGTGAAT 58.732 47.619 0.00 0.0 39.69 2.57 F
1425 1436 0.381089 GATATACGATCCCGCCTCCG 59.619 60.000 0.00 0.0 39.95 4.63 F
1773 1784 0.738389 ACTGCCAGTGTTTTCGTTGG 59.262 50.000 0.00 0.0 0.00 3.77 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1329 1340 1.885049 ACCTGCATACCCATCTCAGT 58.115 50.000 0.00 0.0 0.00 3.41 R
2087 2099 1.855295 TGCCACATTGCCAGAATGAT 58.145 45.000 2.51 0.0 39.69 2.45 R
2420 2434 2.048603 GCCATCAGTTGCCCTGTCC 61.049 63.158 0.96 0.0 42.19 4.02 R
2816 2832 3.011517 AGCAGGCCGGTCATTCCT 61.012 61.111 9.71 0.0 0.00 3.36 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
32 33 0.033228 CGAAATTTGGGGTTGCAGCA 59.967 50.000 2.05 0.00 0.00 4.41
303 306 6.542821 ACTAATTTCATTGAACTCCTGTGGA 58.457 36.000 0.00 0.00 0.00 4.02
426 430 2.268298 GCAGTATGACCGAACGTGAAT 58.732 47.619 0.00 0.00 39.69 2.57
792 801 4.804496 GCGTGTTTGCCACTTTGT 57.196 50.000 0.00 0.00 42.20 2.83
1097 1106 3.456277 AGAAAAGAGGGCGATGAGGTAAT 59.544 43.478 0.00 0.00 0.00 1.89
1144 1155 7.147846 CCTCCTGATTTATGTTATTTGTTGGCT 60.148 37.037 0.00 0.00 0.00 4.75
1145 1156 8.815565 TCCTGATTTATGTTATTTGTTGGCTA 57.184 30.769 0.00 0.00 0.00 3.93
1329 1340 1.555075 ACGATCAAAAGGGAGCTGCTA 59.445 47.619 0.15 0.00 0.00 3.49
1425 1436 0.381089 GATATACGATCCCGCCTCCG 59.619 60.000 0.00 0.00 39.95 4.63
1527 1538 3.949754 ACATATCAAAGTCCCGTACGAGA 59.050 43.478 18.76 5.97 0.00 4.04
1773 1784 0.738389 ACTGCCAGTGTTTTCGTTGG 59.262 50.000 0.00 0.00 0.00 3.77
1996 2008 8.757789 TGTGTGAACTCTTTGTTTATAACGTAG 58.242 33.333 0.00 0.00 39.30 3.51
2087 2099 3.687212 CCATAATGACAACGTGGCAACTA 59.313 43.478 0.00 0.00 39.86 2.24
2096 2108 2.632377 ACGTGGCAACTATCATTCTGG 58.368 47.619 0.00 0.00 37.61 3.86
2737 2752 0.800683 CGGAAGCGAATGCAGTACGA 60.801 55.000 12.72 0.00 46.23 3.43
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
32 33 3.485216 CCTTACAATTCTCGCGCGAAATT 60.485 43.478 33.99 31.32 0.00 1.82
426 430 3.849563 AGTTTAGTTGCCACACACCTA 57.150 42.857 0.00 0.00 0.00 3.08
575 579 7.557358 TGTATGTGGCAACTATCTCATTCATTT 59.443 33.333 0.00 0.00 37.61 2.32
1329 1340 1.885049 ACCTGCATACCCATCTCAGT 58.115 50.000 0.00 0.00 0.00 3.41
1527 1538 8.034215 CAGCTCTTCCTCGATCTCATTATTAAT 58.966 37.037 0.00 0.00 0.00 1.40
1773 1784 5.685954 GTCAGAAATCAAAACGGAAGAAACC 59.314 40.000 0.00 0.00 0.00 3.27
1996 2008 7.546667 ACCAGATTGTCATGCATGAAATAAAAC 59.453 33.333 30.24 18.85 38.75 2.43
2087 2099 1.855295 TGCCACATTGCCAGAATGAT 58.145 45.000 2.51 0.00 39.69 2.45
2096 2108 1.885887 TGAAGGTAGTTGCCACATTGC 59.114 47.619 0.00 0.00 0.00 3.56
2420 2434 2.048603 GCCATCAGTTGCCCTGTCC 61.049 63.158 0.96 0.00 42.19 4.02
2737 2752 5.329035 AGAAGCATCAACAAAACAACACT 57.671 34.783 0.00 0.00 0.00 3.55
2816 2832 3.011517 AGCAGGCCGGTCATTCCT 61.012 61.111 9.71 0.00 0.00 3.36


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.