Multiple sequence alignment - TraesCS1B01G075100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G075100 chr1B 100.000 2195 0 0 1 2195 58113594 58115788 0.000000e+00 4054
1 TraesCS1B01G075100 chr1B 99.831 1772 3 0 1 1772 58086949 58088720 0.000000e+00 3256
2 TraesCS1B01G075100 chr1B 99.436 1772 9 1 1 1772 58048015 58049785 0.000000e+00 3216
3 TraesCS1B01G075100 chr1B 87.808 1419 172 1 775 2193 58326423 58327840 0.000000e+00 1661
4 TraesCS1B01G075100 chr1B 87.192 1421 177 5 777 2195 57789388 57790805 0.000000e+00 1611
5 TraesCS1B01G075100 chr1B 83.041 342 53 4 426 763 58326101 58326441 2.740000e-79 305
6 TraesCS1B01G075100 chr1B 83.007 153 22 4 295 445 57139737 57139587 3.800000e-28 135
7 TraesCS1B01G075100 chr1D 90.295 1422 133 5 775 2194 38365773 38367191 0.000000e+00 1857
8 TraesCS1B01G075100 chr1D 87.825 1421 169 4 777 2195 38257431 38258849 0.000000e+00 1663
9 TraesCS1B01G075100 chr1D 87.614 1421 171 4 775 2193 38558047 38559464 0.000000e+00 1644
10 TraesCS1B01G075100 chr1D 81.105 561 92 11 210 763 38557512 38558065 9.310000e-119 436
11 TraesCS1B01G075100 chr1D 91.667 312 24 2 1 311 38587582 38587892 4.330000e-117 431
12 TraesCS1B01G075100 chr1D 77.215 474 82 19 300 763 36615502 36615959 1.010000e-63 254
13 TraesCS1B01G075100 chr1D 84.190 253 39 1 510 762 38365539 38365790 6.050000e-61 244
14 TraesCS1B01G075100 chr1D 86.486 222 26 3 544 763 36622152 36622371 7.830000e-60 241
15 TraesCS1B01G075100 chr1A 90.318 1291 122 3 781 2070 37510079 37511367 0.000000e+00 1688
16 TraesCS1B01G075100 chr1A 87.491 1423 169 8 775 2193 37503080 37504497 0.000000e+00 1633
17 TraesCS1B01G075100 chr1A 90.531 433 23 2 333 763 37509675 37510091 6.850000e-155 556
18 TraesCS1B01G075100 chr1A 80.536 560 95 11 210 762 37502545 37503097 3.370000e-113 418
19 TraesCS1B01G075100 chr1A 88.415 164 18 1 1 163 37509514 37509677 1.720000e-46 196
20 TraesCS1B01G075100 chr7A 82.273 220 34 4 1966 2184 627227967 627227752 3.720000e-43 185


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G075100 chr1B 58113594 58115788 2194 False 4054.000000 4054 100.000000 1 2195 1 chr1B.!!$F4 2194
1 TraesCS1B01G075100 chr1B 58086949 58088720 1771 False 3256.000000 3256 99.831000 1 1772 1 chr1B.!!$F3 1771
2 TraesCS1B01G075100 chr1B 58048015 58049785 1770 False 3216.000000 3216 99.436000 1 1772 1 chr1B.!!$F2 1771
3 TraesCS1B01G075100 chr1B 57789388 57790805 1417 False 1611.000000 1611 87.192000 777 2195 1 chr1B.!!$F1 1418
4 TraesCS1B01G075100 chr1B 58326101 58327840 1739 False 983.000000 1661 85.424500 426 2193 2 chr1B.!!$F5 1767
5 TraesCS1B01G075100 chr1D 38257431 38258849 1418 False 1663.000000 1663 87.825000 777 2195 1 chr1D.!!$F3 1418
6 TraesCS1B01G075100 chr1D 38365539 38367191 1652 False 1050.500000 1857 87.242500 510 2194 2 chr1D.!!$F5 1684
7 TraesCS1B01G075100 chr1D 38557512 38559464 1952 False 1040.000000 1644 84.359500 210 2193 2 chr1D.!!$F6 1983
8 TraesCS1B01G075100 chr1A 37502545 37504497 1952 False 1025.500000 1633 84.013500 210 2193 2 chr1A.!!$F1 1983
9 TraesCS1B01G075100 chr1A 37509514 37511367 1853 False 813.333333 1688 89.754667 1 2070 3 chr1A.!!$F2 2069

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
377 379 2.576648 GGTCTACCTTTCCTCACCCATT 59.423 50.0 0.0 0.0 0.0 3.16 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2044 2051 3.815401 ACTTGCAGCTCGTTAATGACTTT 59.185 39.13 0.0 0.0 0.0 2.66 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
377 379 2.576648 GGTCTACCTTTCCTCACCCATT 59.423 50.000 0.00 0.00 0.00 3.16
1838 1845 5.994668 TCATTCCACGTTTAGCATATGCATA 59.005 36.000 28.62 9.27 45.16 3.14
1941 1948 0.321671 ATCCTTCGGTGGCATATCCG 59.678 55.000 8.59 8.59 46.93 4.18
2103 2110 0.885879 GACCCCGGGTTGTCATTTTC 59.114 55.000 21.85 0.00 35.25 2.29
2164 2171 5.014202 TGGAATATCCATGGATCATGCAAG 58.986 41.667 30.61 0.00 42.67 4.01
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
631 637 2.239400 TGTCTCTCTTTTCGAGGAGCA 58.761 47.619 7.10 0.0 40.30 4.26
1906 1913 6.122850 CGAAGGATGCTTTGTTGATATGAA 57.877 37.500 0.00 0.0 0.00 2.57
1941 1948 4.611943 TCGCATACTCTATTCTGCTTCAC 58.388 43.478 0.00 0.0 32.48 3.18
2044 2051 3.815401 ACTTGCAGCTCGTTAATGACTTT 59.185 39.130 0.00 0.0 0.00 2.66
2103 2110 5.904362 AAGAGGCTGCTAAAATGTTTAGG 57.096 39.130 9.24 0.0 0.00 2.69
2164 2171 8.620416 TGCTCAACCAAATAATGTGACATATAC 58.380 33.333 0.00 0.0 0.00 1.47


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.