Multiple sequence alignment - TraesCS1B01G070900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G070900 chr1B 100.000 1816 0 0 790 2605 55993408 55995223 0.000000e+00 3354.0
1 TraesCS1B01G070900 chr1B 100.000 1313 0 0 790 2102 55971683 55972995 0.000000e+00 2425.0
2 TraesCS1B01G070900 chr1B 96.357 1098 12 4 790 1887 56014647 56015716 0.000000e+00 1781.0
3 TraesCS1B01G070900 chr1B 90.779 1117 77 11 792 1887 55953783 55954894 0.000000e+00 1469.0
4 TraesCS1B01G070900 chr1B 90.519 1118 79 11 792 1887 55942529 55943641 0.000000e+00 1452.0
5 TraesCS1B01G070900 chr1B 100.000 761 0 0 1 761 55970621 55971381 0.000000e+00 1406.0
6 TraesCS1B01G070900 chr1B 100.000 761 0 0 1 761 55992619 55993379 0.000000e+00 1406.0
7 TraesCS1B01G070900 chr1B 94.682 771 30 7 1 761 56013783 56014552 0.000000e+00 1186.0
8 TraesCS1B01G070900 chr1B 100.000 492 0 0 2114 2605 55973158 55973649 0.000000e+00 909.0
9 TraesCS1B01G070900 chr1B 99.537 216 1 0 546 761 55971373 55971588 6.760000e-106 394.0
10 TraesCS1B01G070900 chrUn 99.890 1817 1 1 790 2605 319316021 319317837 0.000000e+00 3343.0
11 TraesCS1B01G070900 chr4D 91.390 1115 70 11 792 1884 336661706 336662816 0.000000e+00 1504.0
12 TraesCS1B01G070900 chr4D 93.671 237 9 2 531 761 336661365 336661601 1.480000e-92 350.0
13 TraesCS1B01G070900 chr4D 96.739 184 6 0 303 486 336661177 336661360 9.060000e-80 307.0
14 TraesCS1B01G070900 chr4D 88.571 70 6 2 1877 1945 484757679 484757611 1.660000e-12 84.2
15 TraesCS1B01G070900 chr4B 90.754 1114 77 11 792 1884 414863357 414864465 0.000000e+00 1463.0
16 TraesCS1B01G070900 chr4B 94.093 237 8 2 531 761 414863016 414863252 3.190000e-94 355.0
17 TraesCS1B01G070900 chr4B 96.739 184 6 0 303 486 414862828 414863011 9.060000e-80 307.0
18 TraesCS1B01G070900 chr4A 89.982 1128 77 14 792 1887 136756013 136754890 0.000000e+00 1424.0
19 TraesCS1B01G070900 chr4A 94.093 237 8 2 531 761 136756354 136756118 3.190000e-94 355.0
20 TraesCS1B01G070900 chr4A 96.739 184 6 0 303 486 136756542 136756359 9.060000e-80 307.0
21 TraesCS1B01G070900 chr1A 89.450 1109 76 12 792 1887 35507585 35508665 0.000000e+00 1362.0
22 TraesCS1B01G070900 chr1A 95.510 490 18 3 1 486 35500329 35500818 0.000000e+00 780.0
23 TraesCS1B01G070900 chr1A 94.683 489 23 3 1 486 35532620 35533108 0.000000e+00 756.0
24 TraesCS1B01G070900 chr1A 92.132 394 22 2 1109 1493 35533712 35534105 4.900000e-152 547.0
25 TraesCS1B01G070900 chr1A 93.249 237 10 2 531 761 35533113 35533349 6.900000e-91 344.0
26 TraesCS1B01G070900 chr1A 93.182 220 9 2 548 761 35507257 35507476 4.180000e-83 318.0
27 TraesCS1B01G070900 chr1A 86.061 165 17 3 2444 2605 323100611 323100772 3.450000e-39 172.0
28 TraesCS1B01G070900 chr1A 85.811 148 18 2 2458 2605 488651827 488651971 1.250000e-33 154.0
29 TraesCS1B01G070900 chr2A 93.597 734 39 7 1876 2605 591728129 591728858 0.000000e+00 1088.0
30 TraesCS1B01G070900 chr2A 86.486 148 17 2 2458 2605 124209342 124209486 2.680000e-35 159.0
31 TraesCS1B01G070900 chr5A 93.065 721 45 4 1887 2605 28696848 28696131 0.000000e+00 1050.0
32 TraesCS1B01G070900 chr2B 93.125 640 38 4 1887 2524 732872680 732873315 0.000000e+00 933.0
33 TraesCS1B01G070900 chr1D 90.707 721 31 11 792 1493 36313178 36313881 0.000000e+00 928.0
34 TraesCS1B01G070900 chr1D 94.694 490 21 5 1 486 36312344 36312832 0.000000e+00 756.0
35 TraesCS1B01G070900 chr1D 92.827 237 11 2 531 761 36312837 36313073 3.210000e-89 339.0
36 TraesCS1B01G070900 chr7B 85.512 283 29 7 1886 2160 211451135 211450857 4.240000e-73 285.0
37 TraesCS1B01G070900 chr7B 90.265 113 9 2 1929 2039 144112673 144112785 2.090000e-31 147.0
38 TraesCS1B01G070900 chr7A 88.421 190 16 4 1887 2070 726852704 726852515 9.380000e-55 224.0
39 TraesCS1B01G070900 chr7A 85.780 218 20 4 2397 2605 726851942 726851727 1.210000e-53 220.0
40 TraesCS1B01G070900 chr7A 87.248 149 16 2 2458 2605 642300638 642300784 1.600000e-37 167.0
41 TraesCS1B01G070900 chr6A 84.000 150 19 4 77 225 575562111 575561966 3.500000e-29 139.0
42 TraesCS1B01G070900 chr7D 91.837 49 3 1 1887 1935 33067289 33067336 1.670000e-07 67.6


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G070900 chr1B 55992619 55995223 2604 False 2380.000000 3354 100.000000 1 2605 2 chr1B.!!$F4 2604
1 TraesCS1B01G070900 chr1B 56013783 56015716 1933 False 1483.500000 1781 95.519500 1 1887 2 chr1B.!!$F5 1886
2 TraesCS1B01G070900 chr1B 55953783 55954894 1111 False 1469.000000 1469 90.779000 792 1887 1 chr1B.!!$F2 1095
3 TraesCS1B01G070900 chr1B 55942529 55943641 1112 False 1452.000000 1452 90.519000 792 1887 1 chr1B.!!$F1 1095
4 TraesCS1B01G070900 chr1B 55970621 55973649 3028 False 1283.500000 2425 99.884250 1 2605 4 chr1B.!!$F3 2604
5 TraesCS1B01G070900 chrUn 319316021 319317837 1816 False 3343.000000 3343 99.890000 790 2605 1 chrUn.!!$F1 1815
6 TraesCS1B01G070900 chr4D 336661177 336662816 1639 False 720.333333 1504 93.933333 303 1884 3 chr4D.!!$F1 1581
7 TraesCS1B01G070900 chr4B 414862828 414864465 1637 False 708.333333 1463 93.862000 303 1884 3 chr4B.!!$F1 1581
8 TraesCS1B01G070900 chr4A 136754890 136756542 1652 True 695.333333 1424 93.604667 303 1887 3 chr4A.!!$R1 1584
9 TraesCS1B01G070900 chr1A 35507257 35508665 1408 False 840.000000 1362 91.316000 548 1887 2 chr1A.!!$F4 1339
10 TraesCS1B01G070900 chr1A 35532620 35534105 1485 False 549.000000 756 93.354667 1 1493 3 chr1A.!!$F5 1492
11 TraesCS1B01G070900 chr2A 591728129 591728858 729 False 1088.000000 1088 93.597000 1876 2605 1 chr2A.!!$F2 729
12 TraesCS1B01G070900 chr5A 28696131 28696848 717 True 1050.000000 1050 93.065000 1887 2605 1 chr5A.!!$R1 718
13 TraesCS1B01G070900 chr2B 732872680 732873315 635 False 933.000000 933 93.125000 1887 2524 1 chr2B.!!$F1 637
14 TraesCS1B01G070900 chr1D 36312344 36313881 1537 False 674.333333 928 92.742667 1 1493 3 chr1D.!!$F1 1492
15 TraesCS1B01G070900 chr7A 726851727 726852704 977 True 222.000000 224 87.100500 1887 2605 2 chr7A.!!$R1 718

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
591 810 0.881118 GAGCCGGCAATTCTGTTTCA 59.119 50.0 31.54 0.0 0.0 2.69 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2112 2524 5.24802 TCATTGGTGCTATTGGATTTTTGGT 59.752 36.0 0.0 0.0 0.0 3.67 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
591 810 0.881118 GAGCCGGCAATTCTGTTTCA 59.119 50.0 31.54 0.0 0.0 2.69
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
591 810 1.064906 CCTGTCCAGTGCTCCAATCAT 60.065 52.381 0.0 0.0 0.0 2.45
2112 2524 5.248020 TCATTGGTGCTATTGGATTTTTGGT 59.752 36.000 0.0 0.0 0.0 3.67


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.