Multiple sequence alignment - TraesCS1B01G070500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G070500 chr1B 100.000 3095 0 0 1 3095 55949992 55953086 0.000000e+00 5716.0
1 TraesCS1B01G070500 chr1B 99.760 1666 3 1 1428 3092 55940163 55941828 0.000000e+00 3053.0
2 TraesCS1B01G070500 chr1B 94.591 1627 70 9 761 2374 56010390 56012011 0.000000e+00 2501.0
3 TraesCS1B01G070500 chr1B 92.752 1628 95 10 763 2374 55967250 55968870 0.000000e+00 2331.0
4 TraesCS1B01G070500 chr1B 100.000 680 0 0 1 680 55961055 55961734 0.000000e+00 1256.0
5 TraesCS1B01G070500 chr1B 93.915 756 40 5 1621 2374 55990099 55990850 0.000000e+00 1136.0
6 TraesCS1B01G070500 chr1B 93.069 606 38 3 2491 3095 56012009 56012611 0.000000e+00 883.0
7 TraesCS1B01G070500 chr1B 92.739 606 40 3 2491 3095 55990848 55991450 0.000000e+00 872.0
8 TraesCS1B01G070500 chr1B 100.000 420 0 0 669 1088 55939369 55939788 0.000000e+00 776.0
9 TraesCS1B01G070500 chr1B 89.934 606 39 9 2491 3095 55968868 55969452 0.000000e+00 761.0
10 TraesCS1B01G070500 chr1B 95.238 378 17 1 761 1137 55989155 55989532 5.710000e-167 597.0
11 TraesCS1B01G070500 chr1B 96.591 264 9 0 1237 1500 55989843 55990106 3.660000e-119 438.0
12 TraesCS1B01G070500 chr1B 94.737 38 1 1 676 713 544399639 544399675 1.200000e-04 58.4
13 TraesCS1B01G070500 chr1D 94.134 1483 67 11 897 2374 36307969 36309436 0.000000e+00 2239.0
14 TraesCS1B01G070500 chr1D 92.905 592 36 3 2491 3081 36309434 36310020 0.000000e+00 856.0
15 TraesCS1B01G070500 chr1D 86.624 157 4 8 711 856 36307818 36307968 1.150000e-34 158.0
16 TraesCS1B01G070500 chr1A 93.811 1438 80 9 943 2374 35529301 35530735 0.000000e+00 2154.0
17 TraesCS1B01G070500 chr1A 93.167 1361 86 5 761 2118 35491178 35492534 0.000000e+00 1991.0
18 TraesCS1B01G070500 chr1A 100.000 420 0 0 669 1088 35528729 35529148 0.000000e+00 776.0
19 TraesCS1B01G070500 chr1A 91.903 494 30 5 2492 2979 35498924 35499413 0.000000e+00 682.0
20 TraesCS1B01G070500 chr1A 82.085 681 121 1 1 680 546775216 546775896 5.750000e-162 580.0
21 TraesCS1B01G070500 chr1A 93.803 355 21 1 2742 3095 35531094 35531448 1.630000e-147 532.0
22 TraesCS1B01G070500 chr1A 92.500 240 17 1 2491 2730 35530733 35530971 2.960000e-90 342.0
23 TraesCS1B01G070500 chr1A 86.547 223 25 5 2114 2334 35498654 35498873 1.110000e-59 241.0
24 TraesCS1B01G070500 chr7B 94.868 682 33 1 1 680 659636205 659636886 0.000000e+00 1064.0
25 TraesCS1B01G070500 chr5B 93.833 681 41 1 1 680 599523771 599524451 0.000000e+00 1024.0
26 TraesCS1B01G070500 chr5B 95.122 123 2 2 2373 2495 571209266 571209384 1.130000e-44 191.0
27 TraesCS1B01G070500 chr5B 92.248 129 6 2 2365 2493 407639436 407639560 2.450000e-41 180.0
28 TraesCS1B01G070500 chr2B 89.280 681 71 2 1 680 68232337 68233016 0.000000e+00 852.0
29 TraesCS1B01G070500 chr2B 92.969 128 4 3 2372 2498 385567488 385567611 6.820000e-42 182.0
30 TraesCS1B01G070500 chr3D 86.250 640 85 3 43 680 444708056 444707418 0.000000e+00 691.0
31 TraesCS1B01G070500 chr5D 84.453 521 81 0 160 680 438585240 438585760 5.920000e-142 514.0
32 TraesCS1B01G070500 chr5A 80.775 645 111 11 43 680 54339256 54339894 2.770000e-135 492.0
33 TraesCS1B01G070500 chr5A 82.252 524 87 5 160 680 631738220 631738740 6.090000e-122 448.0
34 TraesCS1B01G070500 chr4B 95.238 126 2 2 2368 2493 467274869 467274990 2.430000e-46 196.0
35 TraesCS1B01G070500 chr4B 94.309 123 3 2 2371 2493 520425975 520425857 5.270000e-43 185.0
36 TraesCS1B01G070500 chr6B 93.600 125 4 1 2370 2494 36133754 36133874 1.900000e-42 183.0
37 TraesCS1B01G070500 chr6D 91.791 134 5 4 2369 2501 36114511 36114639 6.820000e-42 182.0
38 TraesCS1B01G070500 chr3B 91.667 132 7 2 2364 2495 61536204 61536331 2.450000e-41 180.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G070500 chr1B 55949992 55953086 3094 False 5716.000000 5716 100.00000 1 3095 1 chr1B.!!$F1 3094
1 TraesCS1B01G070500 chr1B 55939369 55941828 2459 False 1914.500000 3053 99.88000 669 3092 2 chr1B.!!$F4 2423
2 TraesCS1B01G070500 chr1B 56010390 56012611 2221 False 1692.000000 2501 93.83000 761 3095 2 chr1B.!!$F7 2334
3 TraesCS1B01G070500 chr1B 55967250 55969452 2202 False 1546.000000 2331 91.34300 763 3095 2 chr1B.!!$F5 2332
4 TraesCS1B01G070500 chr1B 55961055 55961734 679 False 1256.000000 1256 100.00000 1 680 1 chr1B.!!$F2 679
5 TraesCS1B01G070500 chr1B 55989155 55991450 2295 False 760.750000 1136 94.62075 761 3095 4 chr1B.!!$F6 2334
6 TraesCS1B01G070500 chr1D 36307818 36310020 2202 False 1084.333333 2239 91.22100 711 3081 3 chr1D.!!$F1 2370
7 TraesCS1B01G070500 chr1A 35491178 35492534 1356 False 1991.000000 1991 93.16700 761 2118 1 chr1A.!!$F1 1357
8 TraesCS1B01G070500 chr1A 35528729 35531448 2719 False 951.000000 2154 95.02850 669 3095 4 chr1A.!!$F4 2426
9 TraesCS1B01G070500 chr1A 546775216 546775896 680 False 580.000000 580 82.08500 1 680 1 chr1A.!!$F2 679
10 TraesCS1B01G070500 chr1A 35498654 35499413 759 False 461.500000 682 89.22500 2114 2979 2 chr1A.!!$F3 865
11 TraesCS1B01G070500 chr7B 659636205 659636886 681 False 1064.000000 1064 94.86800 1 680 1 chr7B.!!$F1 679
12 TraesCS1B01G070500 chr5B 599523771 599524451 680 False 1024.000000 1024 93.83300 1 680 1 chr5B.!!$F3 679
13 TraesCS1B01G070500 chr2B 68232337 68233016 679 False 852.000000 852 89.28000 1 680 1 chr2B.!!$F1 679
14 TraesCS1B01G070500 chr3D 444707418 444708056 638 True 691.000000 691 86.25000 43 680 1 chr3D.!!$R1 637
15 TraesCS1B01G070500 chr5D 438585240 438585760 520 False 514.000000 514 84.45300 160 680 1 chr5D.!!$F1 520
16 TraesCS1B01G070500 chr5A 54339256 54339894 638 False 492.000000 492 80.77500 43 680 1 chr5A.!!$F1 637
17 TraesCS1B01G070500 chr5A 631738220 631738740 520 False 448.000000 448 82.25200 160 680 1 chr5A.!!$F2 520

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1296 1830 2.269241 GAGCCGACCCCCTTTGAG 59.731 66.667 0.0 0.0 0.0 3.02 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2966 3664 4.161565 AGGACCAAAGCGTATAACAGATCA 59.838 41.667 0.0 0.0 0.0 2.92 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1296 1830 2.269241 GAGCCGACCCCCTTTGAG 59.731 66.667 0.0 0.0 0.0 3.02
2966 3664 6.806739 GCTAATTTCTTCGCACCAAGTAAATT 59.193 34.615 0.0 0.0 33.1 1.82
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1423 1957 4.657824 CCACGTCCACCGCTCGTT 62.658 66.667 0.0 0.0 41.42 3.85
2966 3664 4.161565 AGGACCAAAGCGTATAACAGATCA 59.838 41.667 0.0 0.0 0.00 2.92


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.