Multiple sequence alignment - TraesCS1B01G070100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS1B01G070100 chr1B 100.000 2133 0 0 623 2755 55242348 55240216 0.000000e+00 3940
1 TraesCS1B01G070100 chr1B 98.631 1315 18 0 623 1937 55206560 55205246 0.000000e+00 2329
2 TraesCS1B01G070100 chr1B 89.590 1220 97 16 626 1838 55017523 55016327 0.000000e+00 1522
3 TraesCS1B01G070100 chr1B 88.525 1220 102 22 626 1838 54978984 54977796 0.000000e+00 1443
4 TraesCS1B01G070100 chr1B 97.834 831 12 2 1931 2755 55204999 55204169 0.000000e+00 1430
5 TraesCS1B01G070100 chr1B 83.649 844 122 9 921 1755 55428975 55428139 0.000000e+00 780
6 TraesCS1B01G070100 chr1B 100.000 406 0 0 1 406 55242970 55242565 0.000000e+00 750
7 TraesCS1B01G070100 chr1B 99.261 406 3 0 1 406 55207014 55206609 0.000000e+00 734
8 TraesCS1B01G070100 chr1B 96.122 361 13 1 1931 2291 410880822 410881181 3.060000e-164 588
9 TraesCS1B01G070100 chr1B 86.758 219 22 1 41 259 54979338 54979127 1.280000e-58 237
10 TraesCS1B01G070100 chr1B 85.470 234 25 2 26 259 55017891 55017667 4.590000e-58 235
11 TraesCS1B01G070100 chr1B 92.784 97 5 1 290 386 55017665 55017571 3.700000e-29 139
12 TraesCS1B01G070100 chr1B 91.753 97 5 2 290 386 54979125 54979032 6.190000e-27 132
13 TraesCS1B01G070100 chrUn 89.306 1225 93 13 624 1838 10695432 10696628 0.000000e+00 1502
14 TraesCS1B01G070100 chrUn 84.099 1132 151 20 633 1755 10650630 10651741 0.000000e+00 1066
15 TraesCS1B01G070100 chrUn 83.127 1132 164 17 633 1755 353452 354565 0.000000e+00 1007
16 TraesCS1B01G070100 chrUn 82.682 947 132 13 822 1755 10643930 10644857 0.000000e+00 811
17 TraesCS1B01G070100 chrUn 94.271 384 19 3 1 383 10695007 10695388 3.950000e-163 584
18 TraesCS1B01G070100 chr1A 88.908 1154 97 18 673 1816 34892024 34890892 0.000000e+00 1393
19 TraesCS1B01G070100 chr1A 93.980 299 16 2 1 298 34892457 34892160 4.180000e-123 451
20 TraesCS1B01G070100 chr1A 97.980 99 2 0 624 722 34892122 34892024 3.650000e-39 172
21 TraesCS1B01G070100 chr1A 93.000 100 6 1 2306 2405 34550724 34550626 7.950000e-31 145
22 TraesCS1B01G070100 chr1D 82.851 968 133 22 797 1755 35788973 35788030 0.000000e+00 837
23 TraesCS1B01G070100 chr5B 97.507 361 8 1 1931 2290 386559677 386559317 1.400000e-172 616
24 TraesCS1B01G070100 chr2A 95.989 374 13 2 1931 2302 36046387 36046014 8.440000e-170 606
25 TraesCS1B01G070100 chr4B 96.953 361 10 1 1931 2290 93512117 93511757 3.030000e-169 604
26 TraesCS1B01G070100 chr7B 96.399 361 12 1 1931 2290 705810814 705810454 6.570000e-166 593
27 TraesCS1B01G070100 chr7B 96.399 361 12 1 1931 2290 745229113 745228753 6.570000e-166 593
28 TraesCS1B01G070100 chr6B 96.133 362 12 1 1931 2290 718836210 718835849 8.500000e-165 590
29 TraesCS1B01G070100 chr6B 96.122 361 13 1 1931 2290 19336682 19336322 3.060000e-164 588


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS1B01G070100 chr1B 55240216 55242970 2754 True 2345.000000 3940 100.000000 1 2755 2 chr1B.!!$R5 2754
1 TraesCS1B01G070100 chr1B 55204169 55207014 2845 True 1497.666667 2329 98.575333 1 2755 3 chr1B.!!$R4 2754
2 TraesCS1B01G070100 chr1B 55428139 55428975 836 True 780.000000 780 83.649000 921 1755 1 chr1B.!!$R1 834
3 TraesCS1B01G070100 chr1B 55016327 55017891 1564 True 632.000000 1522 89.281333 26 1838 3 chr1B.!!$R3 1812
4 TraesCS1B01G070100 chr1B 54977796 54979338 1542 True 604.000000 1443 89.012000 41 1838 3 chr1B.!!$R2 1797
5 TraesCS1B01G070100 chrUn 10650630 10651741 1111 False 1066.000000 1066 84.099000 633 1755 1 chrUn.!!$F3 1122
6 TraesCS1B01G070100 chrUn 10695007 10696628 1621 False 1043.000000 1502 91.788500 1 1838 2 chrUn.!!$F4 1837
7 TraesCS1B01G070100 chrUn 353452 354565 1113 False 1007.000000 1007 83.127000 633 1755 1 chrUn.!!$F1 1122
8 TraesCS1B01G070100 chrUn 10643930 10644857 927 False 811.000000 811 82.682000 822 1755 1 chrUn.!!$F2 933
9 TraesCS1B01G070100 chr1A 34890892 34892457 1565 True 672.000000 1393 93.622667 1 1816 3 chr1A.!!$R2 1815
10 TraesCS1B01G070100 chr1D 35788030 35788973 943 True 837.000000 837 82.851000 797 1755 1 chr1D.!!$R1 958

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
768 821 1.363807 GCCACTGCAAGGAAACACC 59.636 57.895 8.96 0.0 39.3 4.16 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2029 2389 1.445518 GTGGGTTGGTTTTGGCCTG 59.554 57.895 3.32 0.0 0.0 4.85 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
768 821 1.363807 GCCACTGCAAGGAAACACC 59.636 57.895 8.96 0.00 39.30 4.16
1267 1367 1.073923 CCCAAAGACTGCCTTGGTAGT 59.926 52.381 10.09 10.09 34.79 2.73
1283 1383 6.434652 CCTTGGTAGTAGACTTCTTCTTCTCA 59.565 42.308 0.00 0.00 34.08 3.27
1555 1655 2.504367 AGGGGATGTGTTTGTCTTTCG 58.496 47.619 0.00 0.00 0.00 3.46
1706 1806 8.250143 TCTCAGATGATATACTTACCAAAGCA 57.750 34.615 0.00 0.00 36.05 3.91
1776 1876 6.575162 AGGAATACACCACAAGATTTGTTC 57.425 37.500 0.00 0.00 43.23 3.18
2014 2374 5.119588 CCATGCAAAACTGAAATAAGCACAG 59.880 40.000 0.00 0.00 37.62 3.66
2055 2415 3.142951 CAAAACCAACCCACGATCACTA 58.857 45.455 0.00 0.00 0.00 2.74
2075 2435 7.680730 TCACTAGCTTTCTCACTCCTTTTATT 58.319 34.615 0.00 0.00 0.00 1.40
2211 2573 9.743057 TGCAAACGCTATTTTAAAATATAGCAT 57.257 25.926 24.90 14.31 46.05 3.79
2333 2695 3.679502 TGTTCGATCTTACACTCGTCGTA 59.320 43.478 0.00 0.00 36.33 3.43
2355 2717 3.312736 AACAATGTCCACTTTCCCACT 57.687 42.857 0.00 0.00 0.00 4.00
2499 2865 2.428171 CCACTTTTCCTATGTGGCCATG 59.572 50.000 9.72 0.00 42.91 3.66
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
768 821 3.412386 CCACCTGAGTAACAAGGAAAGG 58.588 50.000 0.00 0.0 0.00 3.11
1267 1367 4.054359 AGCCCTGAGAAGAAGAAGTCTA 57.946 45.455 0.00 0.0 34.56 2.59
1555 1655 2.087646 GGAAGTGAATCAGCCCTTGTC 58.912 52.381 0.00 0.0 0.00 3.18
2029 2389 1.445518 GTGGGTTGGTTTTGGCCTG 59.554 57.895 3.32 0.0 0.00 4.85
2055 2415 9.389755 GAATCTAATAAAAGGAGTGAGAAAGCT 57.610 33.333 0.00 0.0 0.00 3.74
2075 2435 6.665680 AGTGAGAAAGCTAGTGGAAGAATCTA 59.334 38.462 0.00 0.0 0.00 1.98
2083 2443 3.176924 AGGAGTGAGAAAGCTAGTGGA 57.823 47.619 0.00 0.0 0.00 4.02
2211 2573 3.570926 AGTTATAGCGCGCTAATAGCA 57.429 42.857 40.90 23.0 42.58 3.49
2333 2695 4.030216 AGTGGGAAAGTGGACATTGTTTT 58.970 39.130 0.00 0.0 0.00 2.43
2499 2865 4.143986 ACCGAAGAAGATTCAGATTCCC 57.856 45.455 0.00 0.0 0.00 3.97


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.